Five Years Of Implementation Of Guidelines In Hematology And Transfusion Medicine In Brazil.

36

Feasibility And Reproducibility Of Diffusion-weighted Magnetic Resonance Imaging Of The Fetal Brain In Twin-twin Transfusion Syndrome.

The aim of this study is to test the feasibility and reproducibility of diffusion-weighted magnetic resonance imaging (DW-MRI) evaluations of the fetal brains in cases of twin-twin transfusion syndrome (TTTS). From May 2011 to June 2012, 24 patients with severe TTTS underwent MRI scans for evaluation of the fetal brains. Datasets were analyzed offline on axial DW images and apparent diffusion coefficient (ADC) maps by two radiologists. The subjective evaluation was described as the absence or presence of water diffusion restriction. The objective evaluation was performed by the placement of 20-mm(2) circular regions of interest on the DW image and ADC maps. Subjective interobserver agreement was assessed by the kappa correlation coefficient. Objective intraobserver and interobserver agreements were assessed by proportionate Bland-Altman tests. Seventy-four DW-MRI scans were performed. Sixty of them (81.1%) were considered to be of good quality. Agreement between the radiologists was 100% for the absence or presence of diffusion restriction of water. For both intraobserver and interobserver agreement of ADC measurements, proportionate Bland-Altman tests showed average percentage differences of less than 1.5% and 95% CI of less than 18% for all sites evaluated. Our data demonstrate that DW-MRI evaluation of the fetal brain in TTTS is feasible and reproducible.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Human Herpesvirus-6 And Cytomegalovirus Dna In Liver Donor Biopsies And Their Correlation With Hla Matches And Acute Cellular Rejection.

Herpesvirus reactivation is common after liver transplantation. Analyze the presence of cytomegalovirus (HCMV) and human herpesvirus-6 (HHV-6) DNA in liver donor biopsies, seeking to better understand issues involving human donor leukocyte antigens (HLA)-A, B and DR, as well as correlations with acute cellular rejection. Fifty-nine liver transplantation patients were investigated for the presence of HCMV and HHV-6 DNA in liver donor biopsies, using the Nested-PCR technique. The clinical donor information and HLA matches were obtained from the São Paulo State Transplant System. The recipients' records regarding acute cellular rejection were studied. Seven (11.8%) biopsies were positive for HCMV DNA and 29 (49%) were positive for HHV-6 DNA. In 14 donors with HLA-DR 15 nine had HHV-6 DNA positive liver biopsy with a tendency for significant association (p=0.09), 22 recipients developed acute cellular rejection and 9/22 were positive for HLA-DR 15 (p=0.03; χ(2)=4.51), which was statistically significant in univariate analysis and showed a tendency after multivariate analysis (p=0.08). HHV-6 DNA was prevalent in liver donors studied as well as HLA-DR 15. These findings suggest that patients with HLA-DR 15 in liver donor biopsies develop more rejection after liver transplantation.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Bartonella Spp. Bacteremia In Blood Donors From Campinas, Brazil.

Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.

Twin-twin Transfusion Syndrome: Neurodevelopmental Screening Test.

Objective To assess the neurodevelopmental functions (cognition, language and motor function) of survivors of twin-twin transfusion syndrome (TTTS). Method Observational cross-sectional study of a total of 67 monochorionic diamniotic twins who underwent fetoscopic laser coagulation (FLC) for treatment of TTTS. The study was conducted at the Center for Investigation in Pediatrics (CIPED), Universidade Estadual de Campinas. Ages ranged from one month and four days to two years four months. Bayley Scales of Infant and Toddler Development Screening Test-III, were used for evaluation. Results Most children reached the competent category and were classified as having appropriate performance. The preterm children scored worse than term infants for gross motor subtest (p = 0.036). Conclusion The majority of children reached the expected development according to their age. Despite the good neurodevelopment, children classified at risk should be monitored for development throughout childhood.

Bartonella Clarridgeiae Bacteremia Detected In An Asymptomatic Blood Donor.

Human exposure to Bartonella clarridgeiae has been reported only on the basis of antibody detection. We report for the first time an asymptomatic human blood donor infected with B. clarridgeiae, as documented by enrichment blood culture, PCR, and DNA sequencing.

Cromatografia de afinidade por íons metálicos imobilizados (IMAC) de biomoléculas: aspectos fundamentais e aplicações tecnológicas

Immobilized Metal Ion Affinity Cromatography - IMAC - is a group-specific based adsorption applied to the purification and structure-function studies of proteins and nucleic acids. The adsorption is based on coordination between a metal ion chelated on the surface of a solid matrix and electron donor groups at the surface of the biomolecule. IMAC is a highly selective, low cost, and easily scaled-up technique being used in research and commercial operations. A separation process can be designed for a specific molecule by just selecting an appropriate metal ion, chelating agent, and operational conditions such as pH, ionic strength, and buffer type.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.