13 resultados para detection-by-tracking

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Flavanones (hesperidin, naringenin, naringin, and poncirin) in industrial, hand-squeezed orange juices and from fresh-in-squeeze machines orange juices were determined by HPLC/DAD analysis using a previously described liquid-liquid extraction method. Method validation including the accuracy was performed by using recovery tests. Samples (36) collected from different Brazilian locations and brands were analyzed. Concentrations were determined using an external standard curve. The limits of detection (LOD) and the limits of quantification (LOQ) calculated were 0.0037, 1.87, 0.0147, and 0.0066 mg 100 g(-1) and 0.0089, 7.84, 0.0302, and 0.0200 mg 100 g(-1) for naringin, hesperidin, poncirin, and naringenin, respectively. The results demonstrated that hesperidin was present at the highest concentration levels, especially in the industrial orange juices. Its average content and concentration range were 69.85 and 18.80-139.00 mg 100 g(-1). The other flavanones showed the lowest concentration levels. The average contents and concentration ranges found were 0.019, 0.01-0.30, and 0.12 and 0.1-0.17, 0.13, and 0.01-0.36 mg 100 g(-1), respectively. The results were also evaluated using the principal component analysis (PCA) multivariate analysis technique which showed that poncirin, naringenin, and naringin were the principal elements that contributed to the variability in the sample concentrations.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This clinical study has investigated the antigenic activity of bacterial contents from exudates of acute apical abscesses (AAAs) and their paired root canal contents regarding the stimulation capacity by levels of interleukin (IL)-1 beta and tumor necrosis factor alpha (TNF-α) throughout the root canal treatment against macrophage cells. Paired samples of infected root canals and exudates of AAAs were collected from 10 subjects. Endodontic contents were sampled before (root canal sample [RCS] 1) and after chemomechanical preparation (RCS2) and after 30 days of intracanal medication with calcium hydroxide + chlorhexidine gel (Ca[OH]2 + CHX gel) (RCS3). Polymerase chain reaction (16S rDNA) was used for detection of the target bacteria, whereas limulus amebocyte lysate was used to measure endotoxin levels. Raw 264.7 macrophages were stimulated with AAA exudates from endodontic contents sampled in different moments of root canal treatment. Enzyme-linked immunosorbent assays were used to measure the levels of TNF-α and IL-1 beta. Parvimonas micra, Porphyromonas endodontalis, Dialister pneumosintes, and Prevotella nigrescens were the most frequently detected species. Higher levels of endotoxins were found in samples from periapical exudates at RCS1 (P < .005). In fact, samples collected from periapical exudates showed a higher stimulation capacity at RCS1 (P < .05). A positive correlation was found between endotoxins from exudates with IL-1 beta (r = 0.97) and TNF-α (r = 0.88) production (P < .01). The significant reduction of endotoxins and bacterial species achieved by chemomechanical procedures (RCS2) resulted in a lower capacity of root canal contents to stimulate the cells compared with that at RCS1 (P < .05). The use of Ca(OH)2 + CHX gel as an intracanal medication (RCS3) improved the removal of endotoxins and bacteria from infected root canals (P < .05) whose contents induced a lower stimulation capacity against macrophages cells at RCS1, RCS2, and RCS3 (P < .05). AAA exudates showed higher levels of endotoxins and showed a greater capacity of macrophage stimulation than the paired root canal samples. Moreover, the use of intracanal medication improved the removal of bacteria and endotoxins from infected root canals, which may have resulted in the reduction of the inflammatory potential of the root canal content.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An HPLC-PAD method using a gold working electrode and a triple-potential waveform was developed for the simultaneous determination of streptomycin and dihydrostreptomycin in veterinary drugs. Glucose was used as the internal standard, and the triple-potential waveform was optimized using a factorial and a central composite design. The optimum potentials were as follows: amperometric detection, E1=-0.15V; cleaning potential, E2=+0.85V; and reactivation of the electrode surface, E3=-0.65V. For the separation of the aminoglycosides and the internal standard of glucose, a CarboPac™ PA1 anion exchange column was used together with a mobile phase consisting of a 0.070 mol L(-1) sodium hydroxide solution in the isocratic elution mode with a flow rate of 0.8 mL min(-1). The method was validated and applied to the determination of streptomycin and dihydrostreptomycin in veterinary formulations (injection, suspension and ointment) without any previous sample pretreatment, except for the ointments, for which a liquid-liquid extraction was required before HPLC-PAD analysis. The method showed adequate selectivity, with an accuracy of 98-107% and a precision of less than 3.9%.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.99580%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física