One Step Forward: Contrasting The Effects Of Toe Clipping And Pit Tagging On Frog Survival And Recapture Probability.

Amphibians have been declining worldwide and the comprehension of the threats that they face could be improved by using mark-recapture models to estimate vital rates of natural populations. Recently, the consequences of marking amphibians have been under discussion and the effects of toe clipping on survival are debatable, although it is still the most common technique for individually identifying amphibians. The passive integrated transponder (PIT tag) is an alternative technique, but comparisons among marking techniques in free-ranging populations are still lacking. We compared these two marking techniques using mark-recapture models to estimate apparent survival and recapture probability of a neotropical population of the blacksmith tree frog, Hypsiboas faber. We tested the effects of marking technique and number of toe pads removed while controlling for sex. Survival was similar among groups, although slightly decreased from individuals with one toe pad removed, to individuals with two and three toe pads removed, and finally to PIT-tagged individuals. No sex differences were detected. Recapture probability slightly increased with the number of toe pads removed and was the lowest for PIT-tagged individuals. Sex was an important predictor for recapture probability, with males being nearly five times more likely to be recaptured. Potential negative effects of both techniques may include reduced locomotion and high stress levels. We recommend the use of covariates in models to better understand the effects of marking techniques on frogs. Accounting for the effect of the technique on the results should be considered, because most techniques may reduce survival. Based on our results, but also on logistical and cost issues associated with PIT tagging, we suggest the use of toe clipping with anurans like the blacksmith tree frog.

A Highly Improved Method For Sensitive Determination Of Amitriptyline In Pharmaceutical Formulations Using An Unmodified Carbon Nanotube Electrode In The Presence Of Sulfuric Acid.

The present paper describes a novel, simple and reliable differential pulse voltammetric method for determining amitriptyline (AMT) in pharmaceutical formulations. It has been described for many authors that this antidepressant is electrochemically inactive at carbon electrodes. However, the procedure proposed herein consisted in electrochemically oxidizing AMT at an unmodified carbon nanotube paste electrode in the presence of 0.1 mol L(-1) sulfuric acid used as electrolyte. At such concentration, the acid facilitated the AMT electroxidation through one-electron transfer at 1.33 V vs. Ag/AgCl, as observed by the augmentation of peak current. Concerning optimized conditions (modulation time 5 ms, scan rate 90 mV s(-1), and pulse amplitude 120 mV) a linear calibration curve was constructed in the range of 0.0-30.0 μmol L(-1), with a correlation coefficient of 0.9991 and a limit of detection of 1.61 μmol L(-1). The procedure was successfully validated for intra- and inter-day precision and accuracy. Moreover, its feasibility was assessed through analysis of commercial pharmaceutical formulations and it has been compared to the UV-vis spectrophotometric method used as standard analytical technique recommended by the Brazilian Pharmacopoeia.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Assessment Of Robustness On Analysis Using Headspace Solid-phase Microextraction And Comprehensive Two-dimensional Gas Chromatography Through Experimental Designs.

Plackett-Burman experimental design was applied for the robustness assessment of GC×GC-qMS (Comprehensive Two-Dimensional Gas Chromatography with Fast Quadrupolar Mass Spectrometric Detection) in quantitative and qualitative analysis of volatiles compounds from chocolate samples isolated by headspace solid-phase microextraction (HS-SPME). The influence of small changes around the nominal level of six factors deemed as important on peak areas (carrier gas flow rate, modulation period, temperature of ionic source, MS photomultiplier power, injector temperature and interface temperature) and of four factors considered as potentially influential on spectral quality (minimum and maximum limits of the scanned mass ranges, ions source temperature and photomultiplier power). The analytes selected for the study were 2,3,5-trimethylpyrazine, 2-octanone, octanal, 2-pentyl-furan, 2,3,5,6-tetramethylpyrazine, and 2-nonanone e nonanal. The factors pointed out as important on the robustness of the system were photomultiplier power for quantitative analysis and lower limit of mass scanning range for qualitative analysis.

Respiratory Viruses Are Continuously Detected In Children With Chronic Tonsillitis Throughout The Year.

To evaluate the oscillations on the viral detection in adenotonsillar tissues from patients with chronic adenotonsillar diseases as an indicia of the presence of persistent viral infections or acute subclinical infections. Cross-sectional prospective study. Tertiary hospital. The fluctuations of respiratory virus detection were compared to the major climatic variables during a two-year period using adenoids and palatine tonsils from 172 children with adenotonsillar hypertrophy and clinical evidence of obstructive sleep apnoea syndrome or recurrent adenotonsillitis, without symptoms of acute respiratory infection (ARI), by TaqMan real-time PCR. The rate of detection of at least one respiratory virus in adenotonsillar tissue was 87%. The most frequently detected viruses were human adenovirus in 52.8%, human enterovirus in 47.2%, human rhinovirus in 33.8%, human bocavirus in 31.1%, human metapneumovirus in 18.3% and human respiratory syncytial virus in 17.2%. Although increased detection of human enterovirus occurred in summer/autumn months, and there were summer nadirs of human respiratory syncytial virus in both years of the study, there was no obvious viral seasonality in contrast to reports with ARI patients in many regions of the world. Respiratory viruses are continuously highly detected during whole year, and without any clinical symptomatology, indicating that viral genome of some virus can persist in lymphoepithelial tissues of the upper respiratory tract.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Use Of Experimental Design To Optimize A Triple-potential Waveform To Develop A Method For The Determination Of Streptomycin And Dihydrostreptomycin In Pharmaceutical Veterinary Dosage Forms By Hplc-pad.

An HPLC-PAD method using a gold working electrode and a triple-potential waveform was developed for the simultaneous determination of streptomycin and dihydrostreptomycin in veterinary drugs. Glucose was used as the internal standard, and the triple-potential waveform was optimized using a factorial and a central composite design. The optimum potentials were as follows: amperometric detection, E1=-0.15V; cleaning potential, E2=+0.85V; and reactivation of the electrode surface, E3=-0.65V. For the separation of the aminoglycosides and the internal standard of glucose, a CarboPac™ PA1 anion exchange column was used together with a mobile phase consisting of a 0.070 mol L(-1) sodium hydroxide solution in the isocratic elution mode with a flow rate of 0.8 mL min(-1). The method was validated and applied to the determination of streptomycin and dihydrostreptomycin in veterinary formulations (injection, suspension and ointment) without any previous sample pretreatment, except for the ointments, for which a liquid-liquid extraction was required before HPLC-PAD analysis. The method showed adequate selectivity, with an accuracy of 98-107% and a precision of less than 3.9%.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Determination Of The Phenolic Composition From Brazilian Tropical Fruits By Uhplc-ms/ms.

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.995detection (28.85-333.3pg/mL), limit of quantification (96.15-1111pg/mL), inter- and intraday accuracy (>80%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Electrocardiogram, Heart Movement And Heart Rate In The Awake Gecko (hemidactylus Mabouia).

The electrocardiogram (ECG) is the simplest and most effective non-invasive method to assess the electrical activity of the heart and to obtain information on the heart rate (HR) and rhythm. Because information on the HR of very small reptiles (body mass <10 g) is still scarce in the literature, in the present work we describe a procedure for recording the ECG in non-anesthetized geckos (Hemidactylus mabouia, Moreau de Jonnès, 1818) under different conditions, namely manual restraint (MR), spontaneous tonic immobility (TI), and in the non-restrained condition (NR). In the gecko ECG, the P, QRS and T waves were clearly distinguishable. The HR was 2.83 ± 0.02 Hz under MR, which was significantly greater (p < 0.001) than the HR under the TI (1.65 ± 0.09 Hz) and NR (1.60 ± 0.10 Hz) conditions. Spontaneously beating isolated gecko hearts contracted at 0.84 ± 0.03 Hz. The in vitro beating rate was affected in a concentration-dependent fashion by adrenoceptor stimulation with noradrenaline, as well as by the muscarinic cholinergic agonist carbachol, which produced significant positive and negative chronotropic effects, respectively (p < 0.001). To our knowledge, this is the first report on the ECG morphology and HR values in geckos, particularly under TI. The methodology and instrumentation developed here are useful for non-invasive in vivo physiological and pharmacological studies in small reptiles without the need of physical restraint or anesthesia.

Experimental determination of benzene uptake rate in Tenax TA diffusive samplers

This paper proposes a methodology to predict benzene uptake rate in ambient air, using passive samplers with Tenax TA. Variations in the uptake rate were found to occur as a function of the sampling time; and were greater at the beginning of sampling. An empirical model was obtained and values for uptake rate agree with literature. Concentration prediction errors can be minimized by using sampling times of 4 to 14 days, thus avoiding the influence of excessive uptake rates in the initial days and the influence of back diffusion at the end of the sampling period.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.