8 resultados para degenerate primers

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To detect the presence of male DNA in vaginal samples collected from survivors of sexual violence and stored on filter paper. A pilot study was conducted to evaluate 10 vaginal samples spotted on sterile filter paper: 6 collected at random in April 2009 and 4 in October 2010. Time between sexual assault and sample collection was 4-48hours. After drying at room temperature, the samples were placed in a sterile envelope and stored for 2-3years until processing. DNA extraction was confirmed by polymerase chain reaction for human β-globin, and the presence of prostate-specific antigen (PSA) was quantified. The presence of the Y chromosome was detected using primers for sequences in the TSPY (Y7/Y8 and DYS14) and SRY genes. β-Globin was detected in all 10 samples, while 2 samples were positive for PSA. Half of the samples amplified the Y7/Y8 and DYS14 sequences of the TSPY gene and 30% amplified the SRY gene sequence of the Y chromosome. Four male samples and 1 female sample served as controls. Filter-paper spots stored for periods of up to 3years proved adequate for preserving genetic material from vaginal samples collected following sexual violence.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prosopis rubriflora and Prosopis ruscifolia are important species in the Chaquenian regions of Brazil. Because of the restriction and frequency of their physiognomy, they are excellent models for conservation genetics studies. The use of microsatellite markers (Simple Sequence Repeats, SSRs) has become increasingly important in recent years and has proven to be a powerful tool for both ecological and molecular studies. In this study, we present the development and characterization of 10 new markers for P. rubriflora and 13 new markers for P. ruscifolia. The genotyping was performed using 40 P. rubriflora samples and 48 P. ruscifolia samples from the Chaquenian remnants in Brazil. The polymorphism information content (PIC) of the P. rubriflora markers ranged from 0.073 to 0.791, and no null alleles or deviation from Hardy-Weinberg equilibrium (HW) were detected. The PIC values for the P. ruscifolia markers ranged from 0.289 to 0.883, but a departure from HW and null alleles were detected for certain loci; however, this departure may have resulted from anthropic activities, such as the presence of livestock, which is very common in the remnant areas. In this study, we describe novel SSR polymorphic markers that may be helpful in future genetic studies of P. rubriflora and P. ruscifolia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

• We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species. • We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively. • These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

• Microsatellite primers were developed for Orthophytum ophiuroides, a rupicolous bromeliad species endemic to neotropical rocky fields. These microsatellite loci will be used to investigate population differentiation and species cohesion in such fragmented environments. The loci were tested for cross-amplification in related bromeliad species. • Eleven polymorphic microsatellite markers were isolated and characterized from an enriched library of O. ophiuroides. The loci were tested on 42 individuals from two populations of this species. The number of alleles per locus ranged from three to nine and the expected and observed heterozygosities ranged from 0.167 to 0.870 and from 0.369 to 0.958, respectively. Seven loci successfully amplified in other related bromeliad species. • Our results suggest that the microsatellite loci developed here will be useful to assess genetic diversity and gene flow in O. ophiuroides for the investigation of population differentiation and species cohesion in neotropical mountainous habitats.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

• Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.