Electrochemical Oxidation Of Landfill Leachate In A Flow Reactor: Optimization Using Response Surface Methodology.

Response surface methodology based on Box-Behnken (BBD) design was successfully applied to the optimization in the operating conditions of the electrochemical oxidation of sanitary landfill leachate aimed for making this method feasible for scale up. Landfill leachate was treated in continuous batch-recirculation system, where a dimensional stable anode (DSA(©)) coated with Ti/TiO2 and RuO2 film oxide were used. The effects of three variables, current density (milliampere per square centimeter), time of treatment (minutes), and supporting electrolyte dosage (moles per liter) upon the total organic carbon removal were evaluated. Optimized conditions were obtained for the highest desirability at 244.11 mA/cm(2), 41.78 min, and 0.07 mol/L of NaCl and 242.84 mA/cm(2), 37.07 min, and 0.07 mol/L of Na2SO4. Under the optimal conditions, 54.99 % of chemical oxygen demand (COD) and 71.07 ammonia nitrogen (NH3-N) removal was achieved with NaCl and 45.50 of COD and 62.13 NH3-N with Na2SO4. A new kinetic model predicted obtained from the relation between BBD and the kinetic model was suggested.

Classificação e padronização dos tomates cv. Carmem e Débora dentro da CEAGESP - SP

The creation of the Brazilian Program for the Modernization of the Horticulture by the Secretariat of Agriculture and Supplying of the State of São Paulo at CEAGESP, determined the standardization of fruit and vegetables in the follow aspects: degree of coloration, format, calibers, defects and packing. Therefore, the main goal of this research is to correlate the classification given by the Brazilian Program with the one used by the wholesalers at CEAGESP, verifying if the established norms are being fulfilled for cultivar Carmen and Debora (SAKATA SEED). The results showed, that for cultivar Carmem, for the averages of the observed values it does not move away from the norms created by the Program for sizes small and medium. However, for the case of cultivar Debora, the results showed differences between the adopted classifications. The tomatoes were devaluated, because had been commercialized below of the standardization indicated for the Brazilian Program.

Qualidade da classificação do tomate de mesa em unidades de beneficiamento

Quality evaluation of classification was done in two fresh market tomatoes packing house, using electronically and mechanical equipments in two harvest periods, summer and winter seasons. The main goal of this work was to evaluate size and color grading conformity with the standards proposed by the Brazilian Program for Horticulture Modernization and size grading obtainded with the one established by the packer. The cultivar studied was Carmen. The results showed that there was no grade conformity with the fresh tomato quality standards proposed by the Brazilian Program for Horticulture Modernization. The grade conformity obtained when compared with the one programmed by the packer, was only for large sizes, in both equipments. The electronically equipment has presented better performance, over the mechanical, considering grading quality and fruits post-harvest quality. However, the electronically equipment must be constantly monitored to achieve efficiency and investment return. On the other side, for mechanical equipment it will be necessary to review the actual system of size grading, in order to follow the fresh tomato quality standards.

Efeito da temperatura e do teor de umidade na iniciação e desenvolvimento do rizoma de Kohleria eriantha (Benth.) Hanst. (Gesneriaceae)

Kohleria eriantha (Benth.) Hanst is a plant belonging to the family Gesneriaceae, with an underground organ, which is associated with vegetative reproduction. This organ is a rhizome, whose stem bears buds covered with modified leaves that store up starch. In small sections of this rhizome, containing six buds (1.5 to 2.0cm long), only one bud sprouted. The sprouted bud could be differentiated into two morphological pattern: aerial part or rhizome. Sprouting of the rhizome pattern occurred in sections kept on substrate with low water content (1mL of water), or lacking water, whereas sprouting of the aerial part pattern occurred in sections on substrate with high water content (12mL of water). Temperature at 20ºC also stimulated sprouting of the rhizome pattern, regardless of the water volume in the substrate. Sprouting of the rhizome pattern occurred still in sections on substrate to which polyethylene glycol 6000 (PEG) solution was added at the concentrations of 161.2, 235.2 and 340.0g/L, resulting in potentials of -3, -6 and -12 MPa, respectively. Sections kept on substrate with low water content (1 ml of water) showed a reduction in the dry matter content and high osmotic concentration in comparison with those on substrate with high water content. The results obtained revealed that forming of the rhizome pattern was influenced by water content and temperature. It is suggested that sprouting of the rhizome pattern was induced by the low water potential in the sections, when kept on substrate with low water content. Moreover, it was observed that the rhizome buds of Kohleria eriantha showed a high degree of plasticity.

Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon

The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.

Soluções de manutenção na pós-colheita de Chrysanthemum morifolium cv. Dragon

The development and use of techniques that extend the life vase of the flowers, maintaining the quality of the product, is essential for reducing postharvest losses. The objective of this work was to evaluate different solutions for maintenance, associated or not to sucrose, in maintaining the postharvest quality of chrysanthemum stems. The treatments used distilled water, 8-HQC to 100 mg L-1, 8-HQC to 100 mg L-1 + sucrose 50 g L-1, 8-HQC to 200 mg L-1, 8-HQC to 200 mg L-1 + sucrose 50 g L-1. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, color of the flowers, and number of buttons, open flowers and partially open flowers. The combination of 8-HQC 200 mg L-1 + sucrose 50 g L-1 was the best performance that made for maintaining the quality of flower stems, favoring the opening of buttons and turgidity of petals. Sucrose contributed to better maintenance of the reserve substances in the shaft, which had increased the flower vase life.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Efeito de baixas doses de radiação X em feridas suturadas e não suturadas - estudo experimental em ratos

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.