2 resultados para classical fields on non-euclidean manifolds

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat induce apoptosis in non-tumorigenic cells via mitochondrial dysfunction, independent of FASN inhibition.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.