Effect Of Simulated Microwave Disinfection On The Linear Dimensional Change, Hardness And Impact Strength Of Acrylic Resins Processed By Different Polymerizing Cycles.

This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A-- water bath at 74ºC for 9 h; B-- water bath at 74ºC for 8 h and temperature increased to 100ºC for 1 h; C-- water bath at 74ºC for 2 h and temperature increased to 100ºC for 1 h;; and D-- water bath at 120ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 sec was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.

Effect Of Simulated Microwave Disinfection On The Linear Dimensional Change, Hardness And Impact Strength Of Acrylic Resins Processed By Different Polymerization Cycles.

This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A) water bath at 74 ºC for 9 h; B) water bath at 74 ºC for 8 h and temperature increased to 100 ºC for 1 h; C) water bath at 74 ºC for 2 h and temperature increased to 100 ºC for 1 h; and D) water bath at 120 ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37 ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 s was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.

Multitarget Effects Of Quercetin In Leukemia.

This study proposes to investigate quercetin antitumor efficacy in vitro and in vivo, using the P39 cell line as a model. The experimental design comprised leukemic cells or xenografts of P39 cells, treated in vitro or in vivo, respectively, with quercetin; apoptosis, cell-cycle and autophagy activation were then evaluated. Quercetin caused pronounced apoptosis in P39 leukemia cells, followed by Bcl-2, Bcl-xL, Mcl-1 downregulation, Bax upregulation, and mitochondrial translocation, triggering cytochrome c release and caspases activation. Quercetin also induced the expression of FasL protein. Furthermore, our results demonstrated an antioxidant activity of quercetin. Quercetin treatment resulted in an increased cell arrest in G1 phase of the cell cycle, with pronounced decrease in CDK2, CDK6, cyclin D, cyclin E, and cyclin A proteins, decreased Rb phosphorylation and increased p21 and p27 expression. Quercetin induced autophagosome formation in the P39 cell line. Autophagy inhibition induced by quercetin with chloroquine triggered apoptosis but did not alter quercetin modulation in the G1 phase. P39 cell treatment with a combination of quercetin and selective inhibitors of ERK1/2 and/or JNK (PD184352 or SP600125, respectively), significantly decreased cells in G1 phase, this treatment, however, did not change the apoptotic cell number. Furthermore, in vivo administration of quercetin significantly reduced tumor volume in P39 xenografts and confirmed in vitro results regarding apoptosis, autophagy, and cell-cycle arrest. The antitumor activity of quercetin both in vitro and in vivo revealed in this study, point to quercetin as an attractive antitumor agent for hematologic malignancies.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comportamento visual e perfil socioeconômico e demográfico de recém-nascidos prematuros da Maternidade do Hospital das Clínicas de Pernambuco - UFPE

OBJECTIVE: To characterize the behavior of premature newborns in the first year of chronological age. METHODS: This is a cross-sectional descriptive study, bound to a longitudinal study titled: Comparison of visual behavior on the first quarter of year of life of premature nursling born at two maternities of Recife/PE. The sample was composed by 52 premature newborns selected from June, 2007 to June, 2008 from the Maternity of the Federal University of Pernambuco (UFPE). Biological, socioeconomic and demographic data was collected through medical records and interviews with progeny. Newborns were evaluated by the Assessment Guide of Visual Ability in Infants. RESULTS: Most of the newborns were male at a gestational period between 33 weeks and 36 weeks and 6 days, showed a good visual behavior development for the age researched, and most of the families showed good socioeconomical and demographic profile. Besides, it was possible to detect ocular signs in 19% of sample, that were referred to an Ophthalmology Service. CONCLUSION: This study results point out the method like an important key in the early detection and visual screening for premature nursling since the first month of life and it led us to believe that clinical view for occupational therapy intervention must be focused not only on biological risks but also at the influence environment in newborn performance.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Cinética de remoção de lactato na definição de pausas para treinamento intervalado de alta intensidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptações musculares ao treinamento de força com sobrecargas excentricas

Universidade Estadual de Campinas . Faculdade de Educação Física

A ginastica como area de conhecimento na formação profissional em educação fisica : encaminhamentos para uma reestruturação curricular

Universidade Estadual de Campinas . Faculdade de Educação Física