26 resultados para cause specific survival

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Amphibians have been declining worldwide and the comprehension of the threats that they face could be improved by using mark-recapture models to estimate vital rates of natural populations. Recently, the consequences of marking amphibians have been under discussion and the effects of toe clipping on survival are debatable, although it is still the most common technique for individually identifying amphibians. The passive integrated transponder (PIT tag) is an alternative technique, but comparisons among marking techniques in free-ranging populations are still lacking. We compared these two marking techniques using mark-recapture models to estimate apparent survival and recapture probability of a neotropical population of the blacksmith tree frog, Hypsiboas faber. We tested the effects of marking technique and number of toe pads removed while controlling for sex. Survival was similar among groups, although slightly decreased from individuals with one toe pad removed, to individuals with two and three toe pads removed, and finally to PIT-tagged individuals. No sex differences were detected. Recapture probability slightly increased with the number of toe pads removed and was the lowest for PIT-tagged individuals. Sex was an important predictor for recapture probability, with males being nearly five times more likely to be recaptured. Potential negative effects of both techniques may include reduced locomotion and high stress levels. We recommend the use of covariates in models to better understand the effects of marking techniques on frogs. Accounting for the effect of the technique on the results should be considered, because most techniques may reduce survival. Based on our results, but also on logistical and cost issues associated with PIT tagging, we suggest the use of toe clipping with anurans like the blacksmith tree frog.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

For the first time, oxygen terminated cellulose carbon nanoparticles (CCN) was synthesised and applied in gene transfection of pIRES plasmid. The CCN was prepared from catalytic of polyaniline by chemical vapour deposition techniques. This plasmid contains one gene that encodes the green fluorescent protein (GFP) in eukaryotic cells, making them fluorescent. This new nanomaterial and pIRES plasmid formed π-stacking when dispersed in water by magnetic stirring. The frequencies shift in zeta potential confirmed the plasmid strongly connects to the nanomaterial. In vitro tests found that this conjugation was phagocytised by NG97, NIH-3T3 and A549 cell lines making them fluorescent, which was visualised by fluorescent microscopy. Before the transfection test, we studied CCN in cell viability. Both MTT and Neutral Red uptake tests were carried out using NG97, NIH-3T3 and A549 cell lines. Further, we use metabolomics to verify if small amounts of nanomaterial would be enough to cause some cellular damage in NG97 cells. We showed two mechanisms of action by CCN-DNA complex, producing an exogenous protein by the transfected cell and metabolomic changes that contributed by better understanding of glioblastoma, being the major finding of this work. Our results suggested that this nanomaterial has great potential as a gene carrier agent in non-viral based therapy, with low cytotoxicity, good transfection efficiency, and low cell damage in small amounts of nanomaterials in metabolomic tests.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Basic phospholipases A2 (PLA2) are toxic and induce a wide spectrum of pharmacological effects, although the acidic enzyme types are not lethal or cause low lethality. Therefore, it is challenging to elucidate the mechanism of action of acidic phospholipases. This study used the acidic non-toxic Ba SpII RP4 PLA2 from Bothrops alternatus as an antigen to develop anti-PLA2 IgG antibodies in rabbits and used in vivo assays to examine the changes in crude venom when pre-incubated with these antibodies. Using Ouchterlony and western blot analyses on B. alternatus venom, we examined the specificity and sensitivity of phospholipase A2 recognition by the specific antibodies (anti-PLA2 IgG). Neutralisation assays using a non-toxic PLA2 antigen revealed unexpected results. The (indirect) haemolytic activity of whole venom was completely inhibited, and all catalytically active phospholipases A2 were blocked. Myotoxicity and lethality were reduced when the crude venom was pre-incubated with anti-PLA2 immunoglobulins. CK levels in the skeletal muscle were significantly reduced at 6 h, and the muscular damage was more significant at this time-point compared to 3 and 12 h. When four times the LD50 was used (224 μg), half the animals treated with the venom-anti PLA2 IgG mixture survived after 48 h. All assays performed with the specific antibodies revealed that Ba SpII RP4 PLA2 had a synergistic effect on whole-venom toxicity. IgG antibodies against the venom of the Argentinean species B. alternatus represent a valuable tool for elucidation of the roles of acidic PLA2 that appear to have purely digestive roles and for further studies on immunotherapy and snake envenoming in affected areas in Argentina and Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The vast majority of maternal deaths in low-and middle-income countries are preventable. Delay in obtaining access to appropriate health care is a fairly common problem which can be improved. The objective of this study was to explore the association between delay in providing obstetric health care and severe maternal morbidity/death. This was a multicentre cross-sectional study, involving 27 referral obstetric facilities in all Brazilian regions between 2009 and 2010. All women admitted to the hospital with a pregnancy-related cause were screened, searching for potentially life-threatening conditions (PLTC), maternal death (MD) and maternal near-miss (MNM) cases, according to the WHO criteria. Data on delays were collected by medical chart review and interview with the medical staff. The prevalence of the three different types of delays was estimated according to the level of care and outcome of the complication. For factors associated with any delay, the PR and 95%CI controlled for cluster design were estimated. A total of 82,144 live births were screened, with 9,555 PLTC, MNM or MD cases prospectively identified. Overall, any type of delay was observed in 53.8% of cases; delay related to user factors was observed in 10.2%, 34.6% of delays were related to health service accessibility and 25.7% were related to quality of medical care. The occurrence of any delay was associated with increasing severity of maternal outcome: 52% in PLTC, 68.4% in MNM and 84.1% in MD. Although this was not a population-based study and the results could not be generalized, there was a very clear and significant association between frequency of delay and severity of outcome, suggesting that timely and proper management are related to survival.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mining activities pose severe environmental risks worldwide, generating extreme pH conditions and high concentrations of heavy metals, which can have major impacts on the survival of organisms. In this work, pyrosequencing of the V3 region of the 16S rDNA was used to analyze the bacterial communities in soil samples from a Brazilian copper mine. For the analysis, soil samples were collected from the slopes (geotechnical structures) and the surrounding drainage of the Sossego mine (comprising the Sossego and Sequeirinho deposits). The results revealed complex bacterial diversity, and there was no influence of deposit geographic location on the composition of the communities. However, the environment type played an important role in bacterial community divergence; the composition and frequency of OTUs in the slope samples were different from those of the surrounding drainage samples, and Acidobacteria, Chloroflexi, Firmicutes, and Gammaproteobacteria were responsible for the observed difference. Chemical analysis indicated that both types of sample presented a high metal content, while the amounts of organic matter and water were higher in the surrounding drainage samples. Non-metric multidimensional scaling (N-MDS) analysis identified organic matter and water as important distinguishing factors between the bacterial communities from the two types of mine environment. Although habitat-specific OTUs were found in both environments, they were more abundant in the surrounding drainage samples (around 50 %), and contributed to the higher bacterial diversity found in this habitat. The slope samples were dominated by a smaller number of phyla, especially Firmicutes. The bacterial communities from the slope and surrounding drainage samples were different in structure and composition, and the organic matter and water present in these environments contributed to the observed differences.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We assessed associations between steroid receptors including: estrogen-alpha, estrogen-beta, androgen receptor, progesterone receptor, the HER2 status and triple-negative epithelial ovarian cancer (ERα-/PR-/HER2-; TNEOC) status and survival in women with epithelial ovarian cancer. The study included 152 women with primary epithelial ovarian cancer. The status of steroid receptor and HER2 was determined by immunohistochemistry. Disease-free and overall survival were calculated and compared with steroid receptor and HER2 status as well as clinicopathological features using the Cox Proportional Hazards model. A mean follow-up period of 43.6 months (interquartile range=41.4 months) was achieved where 44% of patients had serous tumor, followed by mucinous (23%), endometrioid (9%), mixed (9%), undifferentiated (8.5%) and clear cell tumors (5.3%). ER-alpha staining was associated with grade II-III tumors. Progesterone receptor staining was positively associated with a Body Mass Index≥25. Androgen receptor positivity was higher in serous tumors. In stand-alone analysis of receptor contribution to survival, estrogen-alpha positivity was associated with greater disease-free survival. However, there was no significant association between steroid receptor expression, HER2 status, or TNEOC status, and overall survival. Although estrogen-alpha, androgen receptor, progesterone receptor and the HER2 status were associated with key clinical features of the women and pathological characteristics of the tumors, these associations were not implicated in survival. Interestingly, women with TNEOC seem to fare the same way as their counterparts with non-TNEOC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Beta cell destruction in type 1 diabetes (TID) is associated with cellular oxidative stress and mitochondrial pathway of cell death. The aim of this study was to determine whether oxidative stress and mitochondrial dysfunction are present in T1D model (non-obese diabetic mouse, NOD) and if they are related to the stages of disease development. NOD mice were studied at three stages: non-diabetic, pre-diabetic, and diabetic and compared with age-matched Balb/c mice. Mitochondria respiration rates measured at phosphorylating and resting states in liver and soleus biopsies and in isolated liver mitochondria were similar in NOD and Balb/c mice at the three disease stages. However, NOD liver mitochondria were more susceptible to calcium-induced mitochondrial permeability transition as determined by cyclosporine-A-sensitive swelling and by decreased calcium retention capacity in all three stages of diabetes development. Mitochondria H2O2 production rate was higher in non-diabetic, but unaltered in pre-diabetic and diabetic NOD mice. The global cell reactive oxygen species (ROS), but not specific mitochondria ROS production, was significantly increased in NOD lymphomononuclear and stem cells in all disease stages. In addition, marked elevated rates of 2',7'-dichlorodihydrofluorescein (H2DCF) oxidation were observed in pancreatic islets from non-diabetic NOD mice. Using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) and lipidomic approach, we identified oxidized lipid markers in NOD liver mitochondria for each disease stage, most of them being derivatives of diacylglycerols and phospholipids. These results suggest that the cellular oxidative stress precedes the establishment of diabetes and may be the cause of mitochondrial dysfunction that is involved in beta cell death.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Galectin-3 (gal-3) is a β-galactoside binding protein related to many tumoral aspects, e.g. angiogenesis, cell growth and motility and resistance to cell death. Evidence has shown its upregulation upon hypoxia, a common feature in solid tumors such as glioblastoma multiformes (GBM). This tumor presents a unique feature described as pseudopalisading cells, which accumulate large amounts of gal-3. Tumor cells far from hypoxic/nutrient deprived areas express little, if any gal-3. Here, we have shown that the hybrid glioma cell line, NG97ht, recapitulates GBM growth forming gal-3 positive pseudopalisades even when cells are grafted subcutaneously in nude mice. In vitro experiments were performed exposing these cells to conditions mimicking tumor areas that display oxygen and nutrient deprivation. Results indicated that gal-3 transcription under hypoxic conditions requires previous protein synthesis and is triggered in a HIF-1α and NF-κB dependent manner. In addition, a significant proportion of cells die only when exposed simultaneously to hypoxia and nutrient deprivation and demonstrate ROS induction. Inhibition of gal-3 expression using siRNA led to protein knockdown followed by a 1.7-2.2 fold increase in cell death. Similar results were also found in a human GBM cell line, T98G. In vivo, U87MG gal-3 knockdown cells inoculated subcutaneously in nude mice demonstrated decreased tumor growth and increased time for tumor engraftment. These results indicate that gal-3 protected cells from cell death under hypoxia and nutrient deprivation in vitro and that gal-3 is a key factor in tumor growth and engraftment in hypoxic and nutrient-deprived microenvironments. Overexpression of gal-3, thus, is part of an adaptive program leading to tumor cell survival under these stressing conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To develop recommendations for the diagnosis, management and treatment of lupus nephritis in Brazil. Extensive literature review with a selection of papers based on the strength of scientific evidence and opinion of the Commission on Systemic Lupus Erythematosus members, Brazilian Society of Rheumatology. 1) Renal biopsy should be performed whenever possible and if this procedure is indicated; and, when the procedure is not possible, the treatment should be guided with the inference of histologic class. 2) Ideally, measures and precautions should be implemented before starting treatment, with emphasis on attention to the risk of infection. 3) Risks and benefits of treatment should be shared with the patient and his/her family. 4) The use of hydroxychloroquine (preferably) or chloroquine diphosphate is recommended for all patients (unless contraindicated) during induction and maintenance phases. 5) The evaluation of the effectiveness of treatment should be made with objective criteria of response (complete remission/partial remission/refractoriness). 6) ACE inhibitors and/or ARBs are recommended as antiproteinuric agents for all patients (unless contraindicated). 7) The identification of clinical and/or laboratory signs suggestive of proliferative or membranous glomerulonephritis should indicate an immediate implementation of specific therapy, including steroids and an immunosuppressive agent, even though histological confirmation is not possible. 8) Immunosuppressives must be used during at least 36 months, but these medications can be kept for longer periods. Its discontinuation should only be done when the patient achieve and maintain a sustained and complete remission. 9) Lupus nephritis should be considered as refractory when a full or partial remission is not achieved after 12 months of an appropriate treatment, when a new renal biopsy should be considered to assist in identifying the cause of refractoriness and in the therapeutic decision.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.