An Update On The Role Of Adipokines In Arterial Stiffness And Hypertension.

Adipokines are hormones produced by adipocytes and have been involved in multiple pathologic pathways, including inflammatory and cardiovascular complications in essential hypertension. Arterial stiffness is a frequent vascular complication that represents increased cardiovascular risk in hypertensive patients. Adipokines, such as adiponectin, leptin and resistin, might be implicated in hypertension, as well as in vascular alterations associated with this condition. Arterial stiffness has proven to be a predictor of cardiovascular events. Obesity and target-organ damage such as arterial stiffness are features associated with hypertension. This review aims to update the association between adipokines and arterial stiffness in essential and resistant hypertension (RHTN).

Quality Of Life On Arterial Hypertension: Validity Of Known Groups Of Minichal.

Introductions: In the care of hypertension, it is important that health professionals possess available tools that allow evaluating the impairment of the health-related quality of life, according to the severity of hypertension and the risk for cardiovascular events. Among the instruments developed for the assessment of health-related quality of life, there is the Mini-Cuestionario of Calidad de Vida en la Hipertensión Arterial (MINICHAL) recently adapted to the Brazilian culture. Objective: To estimate the validity of known groups of the Brazilian version of the MINICHAL regarding the classification of risk for cardiovascular events, symptoms, severity of dyspnea and target-organ damage. Methods: Data of 200 hypertensive outpatients concerning sociodemographic and clinical information and health-related quality of life were gathered by consulting the medical charts and the application of the Brazilian version of MINICHAL. The Mann-Whitney test was used to compare health-related quality of life in relation to symptoms and target-organ damage. The Kruskal-Wallis test and ANOVA with ranks transformation were used to compare health-related quality of life in relation to the classification of risk for cardiovascular events and intensity of dyspnea, respectively. Results: The MINICHAL was able to discriminate health-related quality of life in relation to symptoms and kidney damage, but did not discriminate health-related quality of life in relation to the classification of risk for cardiovascular events. Conclusion: The Brazilian version of the MINICHAL is a questionnaire capable of discriminating differences on the health‑related quality of life regarding dyspnea, chest pain, palpitation, lipothymy, cephalea and renal damage.Fundamento: No cuidado ao hipertenso, é importante que o profissional de saúde disponha de ferramentas que possibilitem avaliar o comprometimento da qualidade de vida relacionada à saúde, de acordo com a gravidade da hipertensão e o risco para eventos cardiovasculares. Dentre os instrumentos criados para avaliação da qualidade de vida relacionada à saúde, destaca-se o Mini-Cuestionario de Calidad de Vida en la Hipertensión Arterial (MINICHAL), recentemente adaptado para a cultura brasileira. Objetivo: Estimar a validade de grupos conhecidos da versão brasileira do MINICHAL em relação à classificação de risco para eventos cardiovasculares, sintomas, intensidade da dispneia e lesões de órgãos-alvo. Métodos: Foram investigados 200 hipertensos em seguimento ambulatorial, cujos dados sociodemográficos, clínicos e de qualidade de vida relacionada à saúde foram obtidos por meio de consulta ao prontuário e da aplicação da versão brasileira do MINICHAL. O teste de Mann-Whitney foi utilizado para comparar qualidade de vida relacionada à saúde em relação aos sintomas e às lesões de órgãos-alvo. Teste de Kruskal-Wallis e ANOVA com transformação nos ranks foram empregados para comparar qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares e intensidade da dispneia, respectivamente. Resultados: O MINICHAL discriminou qualidade de vida relacionada à saúde em relação aos sintomas e dano renal (lesões de órgãos-alvo), porém não discriminou qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares. Conclusão: A versão brasileira do MINICHAL é um instrumento capaz de discriminar diferenças na qualidade de vida relacionada à saúde em relação aos sintomas de dispneia, precordialgia, palpitação, lipotímia, cefaleia e presença de dano renal.

Respostas agudas da variabilidade da frequência cardíaca após sesão de exercício de força com restrição de fluxo sanguíneo = : Acute responses of heart rate variabiblity afer blood flow restriction resistance exercise

Universidade Estadual de Campinas . Faculdade de Educação Física

The Real-life Experience With Cardiovascular Complications In The First Dose Of Fingolimod For Multiple Sclerosis.

Fingolimod is a new and efficient treatment for multiple sclerosis (MS). The drug administration requires special attention to the first dose, since cardiovascular adverse events can be observed during the initial six hours of fingolimod ingestion. The present study consisted of a review of cardiovascular data on 180 patients with MS receiving the first dose of fingolimod. The rate of bradycardia in these patients was higher than that observed in clinical trials with very strict inclusion criteria for patients. There were less than 10% of cases requiring special attention, but no fatal cases. All but one patient continued the treatment after this initial dose. This is the first report on real-life administration of fingolimod to Brazilian patients with MS, and one of the few studies with these characteristics in the world.

[association Between Breast Arterial Calcifications And Cardiovascular Risk Factors In Menopausal Women].

To analyze associations between mammographic arterial mammary calcifications in menopausal women and risk factors for cardiovascular disease. This was a cross-sectional retrospective study, in which we analyzed the mammograms and medical records of 197 patients treated between 2004 and 2005. Study variables were: breast arterial calcifications, stroke, acute coronary syndrome, age, obesity, diabetes mellitus, smoking, and hypertension. For statistical analysis, we used the Mann-Whitney, χ2 and Cochran-Armitage tests, and also evaluated the prevalence ratios between these variables and mammary artery calcifications. Data were analyzed with the SAS version 9.1 software. In the group of 197 women, there was a prevalence of 36.6% of arterial calcifications on mammograms. Among the risk factors analyzed, the most frequent were hypertension (56.4%), obesity (31.9%), smoking (15.2%), and diabetes (14.7%). Acute coronary syndrome and stroke presented 5.6 and 2.0% of prevalence, respectively. Among the mammograms of women with diabetes, the odds ratio of mammary artery calcifications was 2.1 (95%CI 1.0-4.1), with p-value of 0.02. On the other hand, the mammograms of smokers showed the low occurrence of breast arterial calcification, with an odds ratio of 0.3 (95%CI 0.1-0.8). Hypertension, obesity, diabetes mellitus, stroke and acute coronary syndrome were not significantly associated with breast arterial calcification. The occurrence of breast arterial calcification was associated with diabetes mellitus and was negatively associated with smoking. The presence of calcification was independent of the other risk factors for cardiovascular disease analyzed.

The Effect Of Soy Dietary Supplement And Low Dose Of Hormone Therapy On Main Cardiovascular Health Biomarkers: A Randomized Controlled Trial.

To assess the effects of a soy dietary supplement on the main biomarkers of cardiovascular health in postmenopausal women compared with the effects of low-dose hormone therapy (HT) and placebo. Double-blind, randomized and controlled intention-to-treat trial. Sixty healthy postmenopausal women, aged 40-60 years, 4.1 years mean time since menopause were recruited and randomly assigned to 3 groups: a soy dietary supplement group (isoflavone 90mg), a low-dose HT group (estradiol 1 mg plus noretisterone 0.5 mg) and a placebo group. Lipid profile, glucose level, body mass index, blood pressure and abdominal/hip ratio were evaluated in all the participants at baseline and after 16 weeks. Statistical analyses were performed using the χ2 test, Fisher's exact test, Kruskal-Wallis non-parametric test, analysis of variance (ANOVA), paired Student's t-test and Wilcoxon test. After a 16-week intervention period, total cholesterol decreased 11.3% and LDL-cholesterol decreased 18.6% in the HT group, but both did not change in the soy dietary supplement and placebo groups. Values for triglycerides, HDL-cholesterol, glucose level, body mass index, blood pressure and abdominal/hip ratio did not change over time in any of the three groups. The use of dietary soy supplement did not show any significant favorable effect on cardiovascular health biomarkers compared with HT. The trial is registered at the Brazilian Clinical Trials Registry (Registro Brasileiro de Ensaios Clínicos - ReBEC), number RBR-76mm75.

The Prevalence Of The Metabolically Healthy Obese Phenotype In An Aging Population And Its Association With Subclinical Cardiovascular Disease: The Brazilian Study On Healthy Aging.

Current literature has elucidated a new phenotype, metabolically healthy obese (MHO), with risks of cardiovascular disease similar to that of normal weight individuals. Few studies have examined the MHO phenotype in an aging population, especially in association with subclinical CVD. This cross sectional study population consisted of 208 octogenarians and older. Anthropometrics, biochemical, and radiological parameters were measured to assess obesity, metabolic health (assessed by the National Cholesterol Education Program -Adult Treatment Panel (NCEP-ATP III) criteria), and subclinical measures of CVD. The prevalence of MHO was 13.5% (N = 28). No significant association with MHO was noted for age, coronary artery calcium score, cIMT, or hs-CRP > 3 mg/dl (p = NS). Our results suggest that the MHO phenotype exists in the elderly; however, subclinical CVD measures were not different in sub-group analysis suggesting traditional metabolic risk factor algorithms may not be accurate in the very elderly.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Treinamento físico e fatores de risco cardiovascular em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito de diferentes protocolos de treinamento sobre o risco cardiovascular global = : Effects of different training programs on global cardiovascular risk

Universidade Estadual de Campinas . Faculdade de Educação Física

Estudo dos padrões do movimento respiratorio e do comportamento cardiovascular em mulheres idosas praticantes de yoga

Universidade Estadual de Campinas . Faculdade de Educação Física