11 resultados para acute events
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This clinical study has investigated the antigenic activity of bacterial contents from exudates of acute apical abscesses (AAAs) and their paired root canal contents regarding the stimulation capacity by levels of interleukin (IL)-1 beta and tumor necrosis factor alpha (TNF-α) throughout the root canal treatment against macrophage cells. Paired samples of infected root canals and exudates of AAAs were collected from 10 subjects. Endodontic contents were sampled before (root canal sample [RCS] 1) and after chemomechanical preparation (RCS2) and after 30 days of intracanal medication with calcium hydroxide + chlorhexidine gel (Ca[OH]2 + CHX gel) (RCS3). Polymerase chain reaction (16S rDNA) was used for detection of the target bacteria, whereas limulus amebocyte lysate was used to measure endotoxin levels. Raw 264.7 macrophages were stimulated with AAA exudates from endodontic contents sampled in different moments of root canal treatment. Enzyme-linked immunosorbent assays were used to measure the levels of TNF-α and IL-1 beta. Parvimonas micra, Porphyromonas endodontalis, Dialister pneumosintes, and Prevotella nigrescens were the most frequently detected species. Higher levels of endotoxins were found in samples from periapical exudates at RCS1 (P < .005). In fact, samples collected from periapical exudates showed a higher stimulation capacity at RCS1 (P < .05). A positive correlation was found between endotoxins from exudates with IL-1 beta (r = 0.97) and TNF-α (r = 0.88) production (P < .01). The significant reduction of endotoxins and bacterial species achieved by chemomechanical procedures (RCS2) resulted in a lower capacity of root canal contents to stimulate the cells compared with that at RCS1 (P < .05). The use of Ca(OH)2 + CHX gel as an intracanal medication (RCS3) improved the removal of endotoxins and bacteria from infected root canals (P < .05) whose contents induced a lower stimulation capacity against macrophages cells at RCS1, RCS2, and RCS3 (P < .05). AAA exudates showed higher levels of endotoxins and showed a greater capacity of macrophage stimulation than the paired root canal samples. Moreover, the use of intracanal medication improved the removal of bacteria and endotoxins from infected root canals, which may have resulted in the reduction of the inflammatory potential of the root canal content.
Resumo:
Herpesvirus reactivation is common after liver transplantation. Analyze the presence of cytomegalovirus (HCMV) and human herpesvirus-6 (HHV-6) DNA in liver donor biopsies, seeking to better understand issues involving human donor leukocyte antigens (HLA)-A, B and DR, as well as correlations with acute cellular rejection. Fifty-nine liver transplantation patients were investigated for the presence of HCMV and HHV-6 DNA in liver donor biopsies, using the Nested-PCR technique. The clinical donor information and HLA matches were obtained from the São Paulo State Transplant System. The recipients' records regarding acute cellular rejection were studied. Seven (11.8%) biopsies were positive for HCMV DNA and 29 (49%) were positive for HHV-6 DNA. In 14 donors with HLA-DR 15 nine had HHV-6 DNA positive liver biopsy with a tendency for significant association (p=0.09), 22 recipients developed acute cellular rejection and 9/22 were positive for HLA-DR 15 (p=0.03; χ(2)=4.51), which was statistically significant in univariate analysis and showed a tendency after multivariate analysis (p=0.08). HHV-6 DNA was prevalent in liver donors studied as well as HLA-DR 15. These findings suggest that patients with HLA-DR 15 in liver donor biopsies develop more rejection after liver transplantation.
Resumo:
To evaluate the effects of acute exercise on the TRB3 protein levels and interaction between TRB3/Akt proteins in the hypothalamus of obese rats. In addition, we evaluated the relationship between TRB3 and endoplasmic reticulum stress (ER stress) and verified whether an acute exercise session is able to influence these processes. In the first part of the study, the rats were divided into three groups: control (lean) - fed with a standard rodent chow, DIO - fed with a high fat diet and DIO submitted to a swimming acute exercise protocol (DIO-EXE). In the second part of the study, we used other three groups: control (lean) receiving an intracerebroventricular (i.c.v.) infusion of vehicle, lean receiving an i.c.v. infusion of thapsigargin, and lean receiving an i.c.v infusion of thapsigargin and performing an acute exercise session. Four hours after the exercise session, the food intake was measured and the hypothalamus was dissected and separated for subsequent protein analysis by immunoblotting and Real Time PCR. The acute exercise session reduced the TRB3 protein levels, disrupted the interaction between TRB3/Akt proteins, increased the phosphorylation of Foxo1 and restored the anorexigenic effects of insulin in the hypothalamus of DIO rats. Interestingly, the suppressive effects of acute exercise on TRB3 protein levels may be related, at least in part, to the decrease of ER stress (evaluated though pancreatic ER kinase phosphorylation - pPERK and C/EBP homologous protein - CHOP protein levels) in the hypothalamus. In conclusion, the reduction of hypothalamic TRB3 protein levels mediated by exercise may be associated with the reduction of ER stress. These data provided a new mechanism by which an acute exercise session improves insulin sensitivity in hypothalamus and restores food intake control in obesity.
Resumo:
Recent data suggests that cholesteryl ester transfer protein (CETP) activity may interact with acute stress conditions via inflammatory-oxidative response and thrombogenesis. We investigated this assumption in patients with ST-elevation myocardial infarction (STEMI). Consecutive patients with STEMI (n = 116) were enrolled <24-h of symptoms onset and were followed for 180 days. Plasma levels of C-reactive protein (CRP), interleukin-2 (IL-2), tumor necrosis factor (TNFα), 8-isoprostane, nitric oxide (NOx) and CETP activity were measured at enrollment (D1) and at fifth day (D5). Flow-mediated dilation (FMD) was assessed by ultrasound and coronary thrombus burden (CTB) was evaluated by angiography. Neither baseline nor the change of CETP activity from D1 to D5 was associated with CRP, IL-2, TNFα, 8-isoprostane levels or CTB. The rise in NOx from D1 to D5 was inferior [3.5(-1; 10) vs. 5.5(-1; 12); p < 0.001] and FMD was lower [5.9(5.5) vs. 9.6(6.6); p = 0.047] in patients with baseline CETP activity above the median value than in their counterparts. Oxidized HDL was measured by thiobarbituric acid reactive substances (TBARS) in isolated HDL particles and increased from D1 to D5, and remaining elevated at D30. The change in TBARS content in HDL was associated with CETP activity (r = 0.72; p = 0.014) and FMD (r = -0.61; p = 0.046). High CETP activity at admission was associated with the incidence of sudden death and recurrent MI at 30 days (OR 12.8; 95% CI 1.25-132; p = 0.032) and 180 days (OR 3.3; 95% CI 1.03-10.7; p = 0.044). An enhanced CETP activity during acute phase of STEMI is independently associated with endothelial dysfunction and adverse clinical outcome.
Resumo:
Background: In pathological situations, such as acute myocardial infarction, disorders of motility of the proximal gut can trigger symptoms like nausea and vomiting. Acute myocardial infarction delays gastric emptying (GE) of liquid in rats. Objective: Investigate the involvement of the vagus nerve, α 1-adrenoceptors, central nervous system GABAB receptors and also participation of paraventricular nucleus (PVN) of the hypothalamus in GE and gastric compliance (GC) in infarcted rats. Methods: Wistar rats, N = 8-15 in each group, were divided as INF group and sham (SH) group and subdivided. The infarction was performed through ligation of the left anterior descending coronary artery. GC was estimated with pressure-volume curves. Vagotomy was performed by sectioning the dorsal and ventral branches. To verify the action of GABAB receptors, baclofen was injected via icv (intracerebroventricular). Intravenous prazosin was used to produce chemical sympathectomy. The lesion in the PVN of the hypothalamus was performed using a 1mA/10s electrical current and GE was determined by measuring the percentage of gastric retention (% GR) of a saline meal. Results: No significant differences were observed regarding GC between groups; vagotomy significantly reduced % GR in INF group; icv treatment with baclofen significantly reduced %GR. GABAB receptors were not conclusively involved in delaying GE; intravenous treatment with prazosin significantly reduced GR% in INF group. PVN lesion abolished the effect of myocardial infarction on GE. Conclusion: Gastric emptying of liquids induced through acute myocardial infarction in rats showed the involvement of the vagus nerve, alpha1- adrenergic receptors and PVN.Fundamento: Distúrbios da motilidade do intestino proximal no infarto agudo do miocárdio podem desencadear sintomas digestivos como náuseas e vômitos. O infarto do miocárdio ocasiona retardo do esvaziamento gástrico (EG) de líquido em ratos. Objetivo: Investigar se existe a influência do nervo vago (VGX), adrenoreceptores α-1, receptores GABAB do sistema nervoso central e participação do núcleo paraventricular (NPV) do hipotálamo no esvaziamento gástrico (EG) e complacência gástrica (CG) em ratos infartados. Métodos: Ratos Wistar (n = 8-15) foram divididos em: grupo infarto (INF), sham (SH) e subdivididos. O infarto foi realizado por ligadura da artéria coronária descendente anterior. A complacência gástrica foi estimada com curvas pressão-volume. Realizada vagotomia por secção dos ramos dorsal e ventral. Para verificar a ação dos receptores GABAB foi injetado baclofeno por via intra ventrículo-cerebral. Simpatectomia química foi realizada com prazosina intravenosa (iv), e na lesão do núcleo paraventricular do hipotálamo foi utilizada corrente elétrica de 1mA/10s, com esvaziamento gástrico determinado por medição da retenção gástrica (% RG) de uma refeição salina. Resultados: Não houve diferença significativa na CG. A vagotomia (VGX) reduziu significativamente a %RG; no grupo INF, o tratamento intra ventrículo-cerebral (ivc) com baclofeno reduziu significativamente a % RG; não houve conclusivamente envolvimento dos receptores GABAB em retardar o EG; o tratamento intravenoso com prazosina reduziu significativamente a %RG no grupo INF. A lesão do NPV aboliu o efeito do infarto do miocárdio no EG. Conclusão: O nervo vago, receptores α-adrenérgicos e núcleo paraventricular estão envolvidos no retardo do esvaziamento gástrico no infarto agudo do miocárdio em ratos.
Resumo:
Although Bell's palsy (BP) is the most common cause of peripheral facial palsy (PFP), other etiologies merit investigation. A 60-year-old female patient presented with recurrent bilateral PFP. Although the patient had a history of acute myeloid leukemia (AML), she had initially been diagnosed with BP-related PFP and had been treated accordingly. When the PFP recurred, additional diagnostic tests were performed. The resulting immunohistochemical profile included CD3 positivity in a few reactive T lymphocytes; positivity for myeloperoxidase in atypical cells; and focal positivity for CD34 and proto-oncogene c-kit proteins in neoplastic cells, thus confirming the suspicion of mastoid infiltration caused by relapsed AML. In patients with neoplastic disease, a finding of PFP calls for extensive investigation in order to rule out the involvement of the temporal bone.
Resumo:
We report on two epileptic patients who developed acute psychosis after the use of topiramate (TPM). One patient exhibited severe psychomotor agitation, heteroaggressiveness, auditory and visual hallucinations as well as severe paranoid and mystic delusions. The other patient had psychomotor agitation, depersonalization, derealization, severe anxiety and deluded that he was losing his memory. Both patients had to be taken to the casualty room. After interruption of TPM in one patient and reduction of dose in the other, a full remission of the psychotic symptoms was obtained without the need of antipsychotic drugs. Clinicians should be aware of the possibility of development of acute psychotic symptoms in patients undergoing TPM treatment.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
This paper describes a topiramate induced acute bilateral angle-closure glaucoma. This rare adverse effect is an idiosyncratic reaction characterized by uveal effusion and lens forward displacement, leading to increased intraocular pressure and vision loss. We describe a 55 year-old white woman with migraine, spasmodic torticollis and essential tremor, who developed bilateral acute angle-closure glaucoma, one week after starting topiramate 25 mg/day. She was seen at the Ophthalmology Emergency Department of the Fundação João Penido Burnier (Campinas, SP, Brazil) with a 4 hours history of blurry vision, ocular pain and bright flashes vision. Slit lamp examination revealed moderate conjunctival injection and corneal edema, and shallow anterior chambers. Intraocular pressure was 48 mmHg in both eyes. Fundoscopic examination findings were normal. She was treated with timolol, brimonidine, dorzolamide, pilocarpine, prednisone acetate eye drops and acetazolamide. One hour after those measures, as the intraocular pressure was 30 mmHg, she received a manitol intravenous injection and the intraocular pressure normalized. After 24 hours an iridotomy with Yag laser was performed. Topiramate was discontinued and she was totally recovered after one week.