3 resultados para activity, detection, monitoring, wearable, sensors, accelerometer

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física