Respiratory Viruses Are Continuously Detected In Children With Chronic Tonsillitis Throughout The Year.

To evaluate the oscillations on the viral detection in adenotonsillar tissues from patients with chronic adenotonsillar diseases as an indicia of the presence of persistent viral infections or acute subclinical infections. Cross-sectional prospective study. Tertiary hospital. The fluctuations of respiratory virus detection were compared to the major climatic variables during a two-year period using adenoids and palatine tonsils from 172 children with adenotonsillar hypertrophy and clinical evidence of obstructive sleep apnoea syndrome or recurrent adenotonsillitis, without symptoms of acute respiratory infection (ARI), by TaqMan real-time PCR. The rate of detection of at least one respiratory virus in adenotonsillar tissue was 87%. The most frequently detected viruses were human adenovirus in 52.8%, human enterovirus in 47.2%, human rhinovirus in 33.8%, human bocavirus in 31.1%, human metapneumovirus in 18.3% and human respiratory syncytial virus in 17.2%. Although increased detection of human enterovirus occurred in summer/autumn months, and there were summer nadirs of human respiratory syncytial virus in both years of the study, there was no obvious viral seasonality in contrast to reports with ARI patients in many regions of the world. Respiratory viruses are continuously highly detected during whole year, and without any clinical symptomatology, indicating that viral genome of some virus can persist in lymphoepithelial tissues of the upper respiratory tract.

Impact Of Pharmacist Interventions On Drug-related Problems And Laboratory Markers In Outpatients With Human Immunodeficiency Virus Infection.

Substantial complexity has been introduced into treatment regimens for patients with human immunodeficiency virus (HIV) infection. Many drug-related problems (DRPs) are detected in these patients, such as low adherence, therapeutic inefficacy, and safety issues. We evaluated the impact of pharmacist interventions on CD4+ T-lymphocyte count, HIV viral load, and DRPs in patients with HIV infection. In this 18-month prospective controlled study, 90 outpatients were selected by convenience sampling from the Hospital Dia-University of Campinas Teaching Hospital (Brazil). Forty-five patients comprised the pharmacist intervention group and 45 the control group; all patients had HIV infection with or without acquired immunodeficiency syndrome. Pharmaceutical appointments were conducted based on the Pharmacotherapy Workup method, although DRPs and pharmacist intervention classifications were modified for applicability to institutional service limitations and research requirements. Pharmacist interventions were performed immediately after detection of DRPs. The main outcome measures were DRPs, CD4+ T-lymphocyte count, and HIV viral load. After pharmacist intervention, DRPs decreased from 5.2 (95% confidence interval [CI] =4.1-6.2) to 4.2 (95% CI =3.3-5.1) per patient (P=0.043). A total of 122 pharmacist interventions were proposed, with an average of 2.7 interventions per patient. All the pharmacist interventions were accepted by physicians, and among patients, the interventions were well accepted during the appointments, but compliance with the interventions was not measured. A statistically significant increase in CD4+ T-lymphocyte count in the intervention group was found (260.7 cells/mm(3) [95% CI =175.8-345.6] to 312.0 cells/mm(3) [95% CI =23.5-40.6], P=0.015), which was not observed in the control group. There was no statistical difference between the groups regarding HIV viral load. This study suggests that pharmacist interventions in patients with HIV infection can cause an increase in CD4+ T-lymphocyte counts and a decrease in DRPs, demonstrating the importance of an optimal pharmaceutical care plan.

Low Bone Mass In Human Immunodeficiency Virus-infected Climacteric Women Receiving Antiretroviral Therapy: Prevalence And Associated Factors.

Low bone mineral density (BMD) has been found in human immunodeficiency virus (HIV)-infected patients; however, data on associated factors remain unclear, specifically in middle-aged women. This study aims to evaluate factors associated with low BMD in HIV-positive women. In this cross-sectional study, a questionnaire was administered to 206 HIV-positive women aged 40 to 60 years who were receiving outpatient care. Clinical features, laboratory test results, and BMD were assessed. Yates and Pearson χ(2) tests and Poisson multiple regression analysis were performed. The median age of women was 47.7 years; 75% had nadir CD4 T-cell counts higher than 200, and 77.8% had viral loads below the detection limit. There was no association between low BMD at the proximal femur and lumbar spine (L1-L4) and risk factors associated with HIV infection and highly active antiretroviral therapy. Poisson multiple regression analysis showed that the only factor associated with low BMD at the proximal femur and lumbar spine was postmenopause status. Low BMD is present in more than one third of this population sample, in which most women are using highly active antiretroviral therapy and have a well-controlled disease. The main associated factor is related to estrogen deprivation. The present data support periodic BMD assessments in HIV-infected patients and highlight the need to implement comprehensive menopausal care for these women to prevent bone loss.

Hypertrophic Adenoid Is A Major Infection Site Of Human Bocavirus 1.

Human bocavirus 1 (HBoV1) is associated with respiratory infections worldwide, mainly in children. Similar to other parvoviruses, it is believed that HBoV1 can persist for long periods of time in humans, probably through maintaining concatemers of the virus single-stranded DNA genome in the nuclei of infected cells. Recently, HBoV-1 was detected in high rates in adenoid and palatine tonsils samples from patients with chronic adenotonsillar diseases, but nothing is known about the virus replication levels in those tissues. A 3-year prospective hospital-based study was conducted to detect and quantify HBoV1 DNA and mRNAs in samples of the adenoids (AD), palatine tonsils (PT), nasopharyngeal secretions (NPS), and peripheral blood (PB) from patients undergoing tonsillectomy for tonsillar hypertrophy or recurrent tonsillitis. HBoV1 was detected in 25.3% of the AD samples, while the rates of detection in the PT, NPS, and PB samples were 7.2%, 10.5%, and 1.7%, respectively. The viral loads were higher in AD samples, and 27.3% of the patients with HBoV had mRNA detectable in this tissue. High viral loads and detectable mRNA in the AD were associated with HBoV1 detection in the other sample sites. The adenoids are an important site of HBoV1 replication and persistence in children with tonsillar hypertrophy. The adenoids contain high HBoV1 loads and are frequently positive for HBoV mRNA, and this is associated with the detection of HBoV1 in secretions.

Censored Linear Regression Models For Irregularly Observed Longitudinal Data Using The Multivariate-t Distribution.

In acquired immunodeficiency syndrome (AIDS) studies it is quite common to observe viral load measurements collected irregularly over time. Moreover, these measurements can be subjected to some upper and/or lower detection limits depending on the quantification assays. A complication arises when these continuous repeated measures have a heavy-tailed behavior. For such data structures, we propose a robust structure for a censored linear model based on the multivariate Student's t-distribution. To compensate for the autocorrelation existing among irregularly observed measures, a damped exponential correlation structure is employed. An efficient expectation maximization type algorithm is developed for computing the maximum likelihood estimates, obtaining as a by-product the standard errors of the fixed effects and the log-likelihood function. The proposed algorithm uses closed-form expressions at the E-step that rely on formulas for the mean and variance of a truncated multivariate Student's t-distribution. The methodology is illustrated through an application to an Human Immunodeficiency Virus-AIDS (HIV-AIDS) study and several simulation studies.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Viral hepatitis in patients infected with human immunodeficiency virus

From 1992 to 1995 we studied 232 (69% male, 87% Caucasian) anti-human immunodeficiency virus (anti-HIV) positive Brazilian patients, through a questionnaire; HIV had been acquired sexually by 50%, from blood by 32%, sexually and/or from blood by 16.4% and by an unknown route by 1.7%. Intravenous drug use was reported by 29%; it was the most important risk factor for HIV transmission. The alanine aminotransferase quotient (qALT) was >1 for 40% of the patients, 93.6% had anti-hepatitis A virus antibody, 5.3% presented hepatitis B surface antigen, 44% were anti-hepatitis B core antigen positive and 53.8% were anti-hepatitis C virus (anti-HCV) positive. The anti-HCV test showed a significant association with qALT>1. Patients for whom the probable HIV transmission route was blood had a 10.8 times greater risk of being anti-HCV positive than patients infected by other routes. Among 30 patients submitted to liver biopsy, 18 presented chronic hepatitis.