9 resultados para Using mobile phones for development
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
To verify whether fluorescence in situ hybridization (FISH) of cells from the buccal epithelium could be employed to detect cryptomosaicism with a 45,X lineage in 46,XY patients. Samples of nineteen 46,XY healthy young men and five patients with disorders of sex development (DSD), four 45,X/46,XY and one 46,XY were used. FISH analysis with X and Y specific probes on interphase nuclei from blood lymphocytes and buccal epithelium were analyzed to investigate the proportion of nuclei containing only the signal of the X chromosome. The frequency of nuclei containing only the X signal in the two tissues of healthy men did not differ (p = 0.69). In all patients with DSD this frequency was significantly higher, and there was no difference between the two tissues (p = 0.38), either. Investigation of mosaicism with a 45,X cell line in patients with 46,XY DSD or sterility can be done by FISH directly using cells from the buccal epithelium.
Resumo:
Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.
Resumo:
The segment of the world population showing permanent or temporary lactose intolerance is quite significant. Because milk is a widely consumed food with an high nutritional value, technological alternatives have been sought to overcome this dilemma. Microfiltration combined with pasteurization can not only extend the shelf life of milk but can also maintain the sensory, functional, and nutritional properties of the product. This studied developed a pasteurized, microfiltered, lactose hydrolyzed (delactosed) skim milk (PMLHSM). Hydrolysis was performed using β-galactosidase at a concentration of 0.4mL/L and incubation for approximately 21h at 10±1°C. During these procedures, the degree of hydrolysis obtained (>90%) was accompanied by evaluation of freezing point depression, and the remaining quantity of lactose was confirmed by HPLC. Milk was processed using a microfiltration pilot unit equipped with uniform transmembrane pressure (UTP) ceramic membranes with a mean pore size of 1.4 μm and UTP of 60 kPa. The product was submitted to physicochemical, microbiological, and sensory evaluations, and its shelf life was estimated. Microfiltration reduced the aerobic mesophilic count by more than 4 log cycles. We were able to produce high-quality PMLHSM with a shelf life of 21 to 27d when stored at 5±1°C in terms of sensory analysis and proteolysis index and a shelf life of 50d in regard to total aerobic mesophile count and titratable acidity.
Resumo:
Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.
Resumo:
The Atlantic rainforest species Ocotea catharinensis, Ocotea odorifera, and Ocotea porosa have been extensively harvested in the past for timber and oil extraction and are currently listed as threatened due to overexploitation. To investigate the genetic diversity and population structure of these species, we developed 8 polymorphic microsatellite markers for O. odorifera from an enriched microsatellite library by using 2 dinucleotide repeats. The microsatellite markers were tested for cross-amplification in O. catharinensis and O. porosa. The average number of alleles per locus was 10.2, considering all loci over 2 populations of O. odorifera. Observed and expected heterozygosities for O. odorifera ranged from 0.39 to 0.93 and 0.41 to 0.92 across populations, respectively. Cross-amplification of all loci was successfully observed in O. catharinensis and O. porosa except 1 locus that was found to lack polymorphism in O. porosa. Combined probabilities of identity in the studied Ocotea species were very low ranging from 1.0 x 10-24 to 7.7 x 10-24. The probability of exclusion over all loci estimated for O. odorifera indicated a 99.9% chance of correctly excluding a random nonparent individual. The microsatellite markers described in this study have high information content and will be useful for further investigations on genetic diversity within these species and for subsequent conservation purposes.
Resumo:
There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.
Resumo:
The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.
Resumo:
Ropivacaine (RVC) is an aminoamide local anesthetic widely used in surgical procedures. Studies with RVC encapsulated in liposomes and complexed in cyclodextrins have shown good results, but in order to use RVC for lengthy procedures and during the postoperative period, a still more prolonged anesthetic effect is required. This study therefore aimed to provide extended RVC release and increased upload using modified liposomes. Three types of vesicles were studied: (i) large multilamellar vesicle (LMV), (ii) large multivesicular vesicle (LMVV) and (iii) large unilamellar vesicle (LUV), prepared with egg phosphatidylcholine/cholesterol/α-tocopherol (4:3:0.07 mol%) at pH 7.4. Ionic gradient liposomes (inside: pH 5.5, pH 5.5 + (NH4)2SO4 and pH 7.4 + (NH4)2SO4) were prepared and showed improved RVC loading, compared to conventional liposomes (inside: pH 7.4). An high-performance liquid chromatography analytical method was validated for RVC quantification. The liposomes were characterized in terms of their size, zeta potential, polydispersion, morphology, RVC encapsulation efficiency (EE(%)) and in vitro RVC release. LMVV liposomes provided better performance than LMV or LUV. The best formulations were prepared using pH 5.5 (LMVV 5.5in) or pH 7.4 with 250 mM (NH4)2SO4 in the inner aqueous core (LMVV 7.4in + ammonium sulfate), enabling encapsulation of as much as 2% RVC, with high uptake (EE(%) ∼70%) and sustained release (∼25 h). The encapsulation of RVC in ionic gradient liposomes significantly extended the duration of release of the anesthetic, showing that this strategy could be a viable means of promoting longer-term anesthesia during surgical procedures and during the postoperative period.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.