26 resultados para Ubiquitin-specific protease 14 (USP14)
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The aim of this study was to evaluate the peripheral effect of 15-deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2) in albumin-induced arthritis in temporomandibular joint (TMJ) of rats. Antigen-induced arthritis (AIA) was generated in rats with methylated bovine serum albumin (mBSA) diluted in complete Freund׳s adjuvant. Pretreatment with an intra-articular injection of 15d-PGJ2 (100 ng/TMJ) before mBSA intra-articular injection (10 µg/TMJ) (challenge) in immunized rats significantly reduced the albumin-induced arthritis inflammation. The results demonstrated that 15d-PGJ2 was able to inhibit plasma extravasation, leukocyte migration and the release of inflammatory cytokines IL-6, IL-12, IL-18 and the chemokine CINC-1 in the TMJ tissues. In addition, 15d-PGJ2 was able to increase the expression of the anti-adhesive molecule CD55 and the anti-inflammatory cytokine IL-10. Taken together, it is possible to suggest that 15d-PGJ2 inhibit leukocyte infiltration and subsequently inflammatory process, through a shift in the balance of the pro- and anti-adhesive properties. Thus, 15d-PGJ2 might be used as a potential anti-inflammatory drug to treat arthritis-induced inflammation of the temporomandibular joint.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
Simvastatin, a competitive inhibitor of HMG-CoA reductase widely used in the treatment and prevention of hyperlipidemia-related diseases, has recently been associated to in vitro anticancer stem cell (CSC) actions. However, these effects have not been confirmed in vivo. To assess in vivo anti-CSC effects of simvastatin, female Sprague-Dawley rats with 7,12-dimethyl-benz(a)anthracene (DMBA)-induced mammary cancer and control animals were treated for 14 days with either simvastatin (20 or 40 mg/kg/day) or soybean oil (N = 60). Tumors and normal breast tissues were removed for pathologic examination and immunodetection of CSC markers. At 40 mg/kg/day, simvastatin significantly reduced tumor growth and the expression of most CSC markers. The reduction in tumor growth (80%) could not be explained solely by the decrease in CSCs, since the latter accounted for less than 10% of the neoplasia (differentiated cancer cells were also affected). Stem cells in normal, nonneoplastic breast tissues were not affected by simvastatin. Simvastatin was also associated with a significant decrease in proliferative activity but no increase in cell death. In conclusion, this is the first study to confirm simvastatin anti-CSC actions in vivo, further demonstrating that this effect is specific for neoplastic cells, but not restricted to CSCs, and most likely due to inhibition of cell proliferation.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.
Resumo:
Placental tissue injury is concomitant with tumor development. We investigated tumor-driven placental damage by tracing certain steps of the protein synthesis and degradation pathways under leucine-rich diet supplementation in MAC16 tumor-bearing mice. Cell signaling and ubiquitin-proteasome pathways were assessed in the placental tissues of pregnant mice, which were distributed into three groups on a control diet (pregnant control, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid) and three other groups on a leucine-rich diet (pregnant, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid). MAC tumor growth down-regulated the cell-signaling pathways of the placental tissue and decreased the levels of IRS-1, Akt/PKB, Erk/MAPK, mTOR, p70S6K, STAT3, and STAT6 phosphorylated proteins, as assessed by the multiplex Millipore Luminex assay. Leucine supplementation maintained the levels of these proteins within the established cell-signaling pathways. In the tumor-bearing group (MAC) only, the placental tissue showed increased PC5 mRNA expression, as assessed by quantitative RT-PCR, decreased 19S and 20S protein expression, as assessed by Western blot analysis, and decreased placental tyrosine levels, likely reflecting up-regulation of the ubiquitin-proteasome pathway. Similar effects were found in the pregnant injected with MAC-ascitic fluid group, confirming that the effects of the tumor were mimicked by MAC-ascitic fluid injection. Although tumor progression occurred, the degradation pathway-related protein levels were modulated under leucine-supplementation conditions. In conclusion, tumor evolution reduced the protein expression of the cell-signaling pathway associated with elevated protein degradation, thereby jeopardizing placental activity. Under the leucine-rich diet, the impact of cancer on placental function could be minimized by improving the cell-signaling activity and reducing the proteolytic process.
Resumo:
This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.
Resumo:
Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.
Resumo:
OBJECTIVE: To adapted the critical velocity (CV), RAST test and lactate minimum (LM) to evaluation of female basketball players. METHODS: Twelve well-trained female basketball players (19 ± 1yrs) were submitted to four intensities running (10 - 14 km/h) at shuttle exercise until exhaustion, applied on alternate days. The linear model 'velocity vs. 1/tlim' was adopted to determine the aerobic (CV) and anaerobic (CCA) parameters. The lactate minimum test consisted of two phases: 1) hiperlactatemia induction using the RAST test and 2) incremental test composed by five shuttle run (20-m) at 7, 8, 9, 10, and 12 km/h. Blood samples were collected at the end of each stage. RESULTS: The velocity (vLM) and blood lactate concentration at LM were obtained by two polynomial adjustments: lactate vs. intensity (LM1) and lactate vs. time (LM2). ANOVA one-way, Student t-test and Pearson correlation were used for statistical analysis. The CV was obtained at 10.3 ± 0.2 km/h and the CCA estimated at 73.0 ± 3.4 m. The RAST was capable to induce the hiperlactatemia and to determine the Pmax (3.6 ± 0.2 W/kg), Pmed (2.8 ± 0.1 W/kg), Pmin (2.3 ± 0.1 W/kg) and FI (30 ± 3%). The vLM1 and vLM2 were obtained, respectively, at 9.47 ±0.13 km/h and 9.8 ± 0.13 km/h, and CV was higher than vLM1. CONCLUSION: The results suggest that the non-invasive model can be used to determine the aerobic and anaerobic parameters. Furthermore, the LM test adapted to basketball using RAST and progressive phase was effective to evaluate female athletes considering the specificity of modality, with high success rates observed in polynomial adjustment 'lactate vs. time' (LM2).
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física