Simultaneous determination of B-Group vitamins in enriched cookies

The objective of this research was to determine the levels of enrichment of vitamins B1, B2, B6 and B3 in different types and brands of enriched cookies. The chromatographic separation was performed in a C18 column with gradient elution and UV detection at 254 and 287 nm. The results show that only 5 of the 24 brands evaluated are in accordance with the Brazilian legislation with respect to the vitamin content declared on the labels. However, consumption of approximately 100-150 g of most of the brands supplies the recommended dietary intake for children and adults of the vitamins evaluated.

A Highly Improved Method For Sensitive Determination Of Amitriptyline In Pharmaceutical Formulations Using An Unmodified Carbon Nanotube Electrode In The Presence Of Sulfuric Acid.

The present paper describes a novel, simple and reliable differential pulse voltammetric method for determining amitriptyline (AMT) in pharmaceutical formulations. It has been described for many authors that this antidepressant is electrochemically inactive at carbon electrodes. However, the procedure proposed herein consisted in electrochemically oxidizing AMT at an unmodified carbon nanotube paste electrode in the presence of 0.1 mol L(-1) sulfuric acid used as electrolyte. At such concentration, the acid facilitated the AMT electroxidation through one-electron transfer at 1.33 V vs. Ag/AgCl, as observed by the augmentation of peak current. Concerning optimized conditions (modulation time 5 ms, scan rate 90 mV s(-1), and pulse amplitude 120 mV) a linear calibration curve was constructed in the range of 0.0-30.0 μmol L(-1), with a correlation coefficient of 0.9991 and a limit of detection of 1.61 μmol L(-1). The procedure was successfully validated for intra- and inter-day precision and accuracy. Moreover, its feasibility was assessed through analysis of commercial pharmaceutical formulations and it has been compared to the UV-vis spectrophotometric method used as standard analytical technique recommended by the Brazilian Pharmacopoeia.

Uv-vis Spectra As An Alternative To The Lowry Method For Quantify Hair Damage Induced By Surfactants.

It is well known that long term use of shampoo causes damage to human hair. Although the Lowry method has been widely used to quantify hair damage, it is unsuitable to determine this in the presence of some surfactants and there is no other method proposed in literature. In this work, a different method is used to investigate and compare the hair damage induced by four types of surfactants (including three commercial-grade surfactants) and water. Hair samples were immersed in aqueous solution of surfactants under conditions that resemble a shower (38 °C, constant shaking). These solutions become colored with time of contact with hair and its UV-vis spectra were recorded. For comparison, the amount of extracted proteins from hair by sodium dodecyl sulfate (SDS) and by water were estimated by the Lowry method. Additionally, non-pigmented vs. pigmented hair and also sepia melanin were used to understand the washing solution color and their spectra. The results presented herein show that hair degradation is mostly caused by the extraction of proteins, cuticle fragments and melanin granules from hair fiber. It was found that the intensity of solution color varies with the charge density of the surfactants. Furthermore, the intensity of solution color can be correlated to the amount of proteins quantified by the Lowry method as well as to the degree of hair damage. UV-vis spectrum of hair washing solutions is a simple and straightforward method to quantify and compare hair damages induced by different commercial surfactants.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Validação de metodologia para a determinação simultânea dos antioxidantes sintéticos em óleos vegetais, margarinas e gorduras hidrogenadas por CLAE/UV

The use of antioxidants either to prevent or retard food's lipids oxidation was approved after inquires that verified their security within a daily intake limit. In this study, the methodology was developed and validated for the analysis of synthetic antioxidants: propylgallate (PG), tert-butylhydroquinone (TBHQ), butylhydroxyanisole (BHA), octylgallate (OG) and butylhydroxytoluene (BHT) in vegetables oils, margarine and hydrogenated fats by high performance liquid chromatographic. The methodology revealed itself efficient, with recovery rates above 90% for all antioxidant substances, besides good linearity in concentration range of 40-240 mg kg-1 (r = 0,999), repeatability with CV < 3,7% and limit of quantification 16.55, 10.32, 1.40, 3.76 and 9.30 mg/kg for BHT, BHA, PG, OG and TBHQ, respectively.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Desenvolvimento e validação de método espectrofotométrico para determinação de corante à base de luteína adicionado em iogurte desnatado

A simple analytical method for extraction and quantification of lutein colorant added to yogurt was developed and validated. The method allowed complete extraction of carotenoids using tetrahydrofuran in vortex, followed by centrifugation, partition to diethyl ether/petroleum ether, and drying. The carotenoids dissolved in ethanol were quantified by UV-Vis spectrophotometry. This method showed linearity in the range tested (1.41-13.42 µg g-1), limits of detection and quantification of 0.42 and 1.28 µg g-1, respectively, low relative standard deviation (3.4%) and recovery ranging from 95 to 103%. The method proved reliable for quantification of lutein added to yogurt.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.