Influence Of The Stage Of Ripeness On The Composition Of Iridoids And Phenolic Compounds In Genipap (genipa Americana L.).

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Determination Of The Phenolic Composition From Brazilian Tropical Fruits By Uhplc-ms/ms.

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.99580%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Cheaper Faster Drug Development Validated By The Repositioning Of Drugs Against Neglected Tropical Diseases.

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Environmental Controls In The Water Use Patterns Of A Tropical Cloud Forest Tree Species, Drimys Brasiliensis (winteraceae).

Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.

The Role Of Edaphic Environment And Climate In Structuring Phylogenetic Pattern In Seasonally Dry Tropical Plant Communities.

Seasonally dry tropical plant formations (SDTF) are likely to exhibit phylogenetic clustering owing to niche conservatism driven by a strong environmental filter (water stress), but heterogeneous edaphic environments and life histories may result in heterogeneity in degree of phylogenetic clustering. We investigated phylogenetic patterns across ecological gradients related to water availability (edaphic environment and climate) in the Caatinga, a SDTF in Brazil. Caatinga is characterized by semiarid climate and three distinct edaphic environments - sedimentary, crystalline, and inselberg -representing a decreasing gradient in soil water availability. We used two measures of phylogenetic diversity: Net Relatedness Index based on the entire phylogeny among species present in a site, reflecting long-term diversification; and Nearest Taxon Index based on the tips of the phylogeny, reflecting more recent diversification. We also evaluated woody species in contrast to herbaceous species. The main climatic variable influencing phylogenetic pattern was precipitation in the driest quarter, particularly for herbaceous species, suggesting that environmental filtering related to minimal periods of precipitation is an important driver of Caatinga biodiversity, as one might expect for a SDTF. Woody species tended to show phylogenetic clustering whereas herbaceous species tended towards phylogenetic overdispersion. We also found phylogenetic clustering in two edaphic environments (sedimentary and crystalline) in contrast to phylogenetic overdispersion in the third (inselberg). We conclude that while niche conservatism is evident in phylogenetic clustering in the Caatinga, this is not a universal pattern likely due to heterogeneity in the degree of realized environmental filtering across edaphic environments. Thus, SDTF, in spite of a strong shared environmental filter, are potentially heterogeneous in phylogenetic structuring. Our results support the need for scientifically informed conservation strategies in the Caatinga and other SDTF regions that have not previously been prioritized for conservation in order to take into account this heterogeneity.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Flora arbustivo-arbórea do fragmento de floresta estacional semidecidual do Ribeirão Cachoeira, município de Campinas, SP

An inventory of the woody flora (trees and shrubs), was carried out in the Ribeirão Cachoeria forest (233.7ha, 650m high, 46°55'58''W, 22°50'13''S), the second largest and best conserved fragment of semideciduous tropical forest in the municipality of Campinas, São Paulo state, Southeastern Brazil. The soil is a red-yellow podsol and the climate is of Köppen's Cwag type. Collections were made from August/1996 to September/1997. Only fertile individuals with a perimeter at breast height of 9cm or greater were included in the survey. One hyndred and seventhy five species were identified, belonging to 119 genera and 49 families. The most important families were Myrtaceae (14 species), Rutaceae and Fabaceae (13), Caesalpiniaceae (11), Solanaceae (9), and Rubiaceae (8). Some species were found for the first time in the region: Tachigali multijuga Benth. and Schoepfia brasiliensis A.DC. The flowering peak for most species was from August to October. Maximum fruit production was from August to November. Most species are zoochoric (58%), but 23% were anemochoric and 19% autochoric. The floristic composition of this forest and another 20 forests from São Paulo state were compared. The results obtained indicate the existence of distinct groups of forests. The most homogeneus group contains forests from the municipality of Campinas with similarity of 40%. This suggests that these forests are possibly fragments of a original continuous forest in the Campinas region.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.