18 resultados para Totally asymmetric simple exclusion process

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Different types of water bodies, including lakes, streams, and coastal marine waters, are often susceptible to fecal contamination from a range of point and nonpoint sources, and have been evaluated using fecal indicator microorganisms. The most commonly used fecal indicator is Escherichia coli, but traditional cultivation methods do not allow discrimination of the source of pollution. The use of triplex PCR offers an approach that is fast and inexpensive, and here enabled the identification of phylogroups. The phylogenetic distribution of E. coli subgroups isolated from water samples revealed higher frequencies of subgroups A1 and B23 in rivers impacted by human pollution sources, while subgroups D1 and D2 were associated with pristine sites, and subgroup B1 with domesticated animal sources, suggesting their use as a first screening for pollution source identification. A simple classification is also proposed based on phylogenetic subgroup distribution using the w-clique metric, enabling differentiation of polluted and unpolluted sites.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

20

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Language, culture, and otherness are complementary and also confliting issues representing the central debate on childhood and the child who carries the signals of social and/or ethinical of exclusion. The debate on the social still connected to universal and absolute values and trues, therefore the theme needs a reavaliation on the realm of relativism. Questioning the fact that culture and otherness are expressed by language which are not always visible and explicit, requering a close and deep look at many social realities enpoorvered suburbs and rural areas, white and black children, homeless children, we kept their voices and speaches, their images from their own drawings to understand the way the percept mean they live and they are. These children have a word for school, and also about the process and agents to say by many different ways to express how they look their own world and how the world look at them.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The difficulty in adapting European dairy cows breeds in Brazil affect considerably the milk production sector. Brazilian climatic conditions are not totally favorable and the development of new tecnologies is needed for the animals express their genetic potential, as well as their best feed conversion. An economical analysis of the applied investment in the free-stall climatization equipment in dairy housing, for estimating studies related to profit, possibility of return investment as well as time for this return is necessary. The objective of this research was to evaluate the influence of climatization investment in the milk production process and analyze the economical aspect of this investment. There were used 470 high productive dairy cows with genetic and morphologic homogeneous characteristics, and analyzed in two similar periods. Investment calculations were done using Excell®. The results were satisfactory and the invested capital was proved to return to the producer in a short term, 57 days.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física