Thermodynamic Study Of The Micellization Of Zwitterionic Surfactants And Their Interaction With Polymers In Water By Isothermal Titration Calorimetry.

The micellization of a homologous series of zwitterionic surfactants, a group of sulfobetaines, was studied using isothermal titration calorimetry (ITC) in the temperature range from 15 to 65 °C. The increase in both temperature and the alkyl chain length leads to more negative values of ΔGmic(0) , favoring the micellization. The entropic term (ΔSmic(0)) is predominant at lower temperatures, and above ca. 55-65 °C, the enthalpic term (ΔHmic(0)) becomes prevalent, figuring a jointly driven process as the temperature increases. The interaction of these sulfobetaines with different polymers was also studied by ITC. Among the polymers studied, only two induced the formation of micellar aggregates at lower surfactant concentration: poly(acrylic acid), PAA, probably due to the formation of hydrogen bonds between the carboxylic group of the polymer and the sulfonate group of the surfactant, and poly(sodium 4-styrenesulfonate), PSS, probably due to the incorporation of the hydrophobic styrene group into the micelles. The prevalence of the hydrophobic and not the electrostatic contributions to the interaction between sulfobetaine and PSS was confirmed by an increased interaction enthalpy in the presence of electrolytes (NaCl) and by the observation of a significant temperature dependence, the latter consistent with the proposed removal of hydrophobic groups from water.

Direct Visualization Of The Action Of Triton X-100 On Giant Vesicles Of Erythrocyte Membrane Lipids.

The raft hypothesis proposes that microdomains enriched in sphingolipids, cholesterol, and specific proteins are transiently formed to accomplish important cellular tasks. Equivocally, detergent-resistant membranes were initially assumed to be identical to membrane rafts, because of similarities between their compositions. In fact, the impact of detergents in membrane organization is still controversial. Here, we use phase contrast and fluorescence microscopy to observe giant unilamellar vesicles (GUVs) made of erythrocyte membrane lipids (erythro-GUVs) when exposed to the detergent Triton X-100 (TX-100). We clearly show that TX-100 has a restructuring action on biomembranes. Contact with TX-100 readily induces domain formation on the previously homogeneous membrane of erythro-GUVs at physiological and room temperatures. The shape and dynamics of the formed domains point to liquid-ordered/liquid-disordered (Lo/Ld) phase separation, typically found in raft-like ternary lipid mixtures. The Ld domains are then separated from the original vesicle and completely solubilized by TX-100. The insoluble vesicle left, in the Lo phase, represents around 2/3 of the original vesicle surface at room temperature and decreases to almost 1/2 at physiological temperature. This chain of events could be entirely reproduced with biomimetic GUVs of a simple ternary lipid mixture, 2:1:2 POPC/SM/chol (phosphatidylcholine/sphyngomyelin/cholesterol), showing that this behavior will arise because of fundamental physicochemical properties of simple lipid mixtures. This work provides direct visualization of TX-100-induced domain formation followed by selective (Ld phase) solubilization in a model system with a complex biological lipid composition.

The Effect Of Celastrol, A Triterpene With Antitumorigenic Activity, On Conformational And Functional Aspects Of The Human 90kda Heat Shock Protein Hsp90α, A Chaperone Implicated In The Stabilization Of The Tumor Phenotype.

Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.

Influence Of The Stage Of Ripeness On The Composition Of Iridoids And Phenolic Compounds In Genipap (genipa Americana L.).

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Esi(+)-ms And Gc-ms Study Of The Hydrolysis Of N-azobenzyl Derivatives Of Chitosan.

New N-p-chloro-, N-p-bromo-, and N-p-nitrophenylazobenzylchitosan derivatives, as well as the corresponding azophenyl and azophenyl-p-sulfonic acids, were synthesized by coupling N-benzylvchitosan with aryl diazonium salts. The synthesized molecules were analyzed by UV-Vis, FT-IR, 1H-NMR and 15N-NMR spectroscopy. The capacity of copper chelation by these materials was studied by AAS. Chitosan and the derivatives were subjected to hydrolysis and the products were analyzed by ESI(+)-MS and GC-MS, confirming the formation of N-benzyl chitosan. Furthermore, the MS results indicate that a nucleophilic aromatic substitution (SnAr) reaction occurs under hydrolysis conditions, yielding chloroaniline from N-p-bromo-, and N-p-nitrophenylazo-benzylchitosan as well as bromoaniline from N-p-chloro-, and N-p-nitrophenylazobenzyl-chitosan.

Enhanced Endothelium-dependent Relaxation Of Rat Pulmonary Artery Following β-adrenergic Overstimulation: Involvement Of The No/cgmp/vasp Pathway.

The aim of this study was to investigate whether β-adrenoceptor (β-AR) overstimulation induced by in vivo treatment with isoproterenol (ISO) alters vascular reactivity and nitric oxide (NO) production and signaling in pulmonary arteries. Vehicle or ISO (0.3mgkg(-1)day(-1)) was administered daily to male Wistar rats. After 7days, the jugular vein was cannulated to assess right ventricular (RV) systolic pressure (SP) and end diastolic pressure (EDP). The extralobar pulmonary arteries were isolated to evaluate the relaxation responses, protein expression (Western blot), NO production (diaminofluorescein-2 fluorescence), and cyclic guanosine 3',5'-monophosphate (cGMP) levels (enzyme immunoassay kit). ISO treatment induced RV hypertrophy; however, no differences in RV-SP and EDP were observed. The pulmonary arteries from the ISO-treated group showed enhanced relaxation to acetylcholine that was abolished by the NO synthase (NOS) inhibitor N(ω)-nitro-l-arginine methyl ester (l-NAME); whereas relaxation elicited by sodium nitroprusside, ISO, metaproterenol, mirabegron, or KCl was not affected by ISO treatment. ISO-treated rats displayed enhanced endothelial NOS (eNOS) and vasodilator-stimulated phosphoprotein (VASP) expression in the pulmonary arteries, while phosphodiesterase-5 protein expression decreased. ISO treatment increased NO and cGMP levels and did not induce eNOS uncoupling. The present data indicate that β-AR overactivation enhances the endothelium-dependent relaxation of pulmonary arteries. This effect was linked to an increase in eNOS-derived NO production, cGMP formation and VASP content and to a decrease in phosphodiesterase-5 expression. Therefore, elevated NO bioactivity through cGMP/VASP signaling could represent a protective mechanism of β-AR overactivation on pulmonary circulation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Hegemonia e contra-hegemonia na construção de políticas de esporte e lazer : a experiência do Consórcio Brasília = Hegemony and counter-hegemony in the process of sport and leisure policy-making : the experience of the Consortium Brasilia

Universidade Estadual de Campinas . Faculdade de Educação Física