8 resultados para Stalk-eyed Fly

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A pterosaur bone bed with at least 47 individuals (wing spans: 0.65-2.35 m) of a new species is reported from southern Brazil from an interdunal lake deposit of a Cretaceous desert, shedding new light on several biological aspects of those flying reptiles. The material represents a new pterosaur, Caiuajara dobruskii gen. et sp. nov., that is the southermost occurrence of the edentulous clade Tapejaridae (Tapejarinae, Pterodactyloidea) recovered so far. Caiuajara dobruskii differs from all other members of this clade in several cranial features, including the presence of a ventral sagittal bony expansion projected inside the nasoantorbital fenestra, which is formed by the premaxillae; and features of the lower jaw, like a marked rounded depression in the occlusal concavity of the dentary. Ontogenetic variation of Caiuajara dobruskii is mainly reflected in the size and inclination of the premaxillary crest, changing from small and inclined (∼ 115°) in juveniles to large and steep (∼ 90°) in adults. No particular ontogenetic features are observed in postcranial elements. The available information suggests that this species was gregarious, living in colonies, and most likely precocial, being able to fly at a very young age, which might have been a general trend for at least derived pterosaurs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Sugarcane is a monocot plant that accumulates sucrose to levels of up to 50% of dry weight in the stalk. The mechanisms that are involved in sucrose accumulation in sugarcane are not well understood, and little is known with regard to factors that control the extent of sucrose storage in the stalks. UDP-glucose pyrophosphorylase (UGPase; EC 2.7.7.9) is an enzyme that produces UDP-glucose, a key precursor for sucrose metabolism and cell wall biosynthesis. The objective of this work was to gain insights into the ScUGPase-1 expression pattern and regulatory mechanisms that control protein activity. ScUGPase-1 expression was negatively correlated with the sucrose content in the internodes during development, and only slight differences in the expression patterns were observed between two cultivars that differ in sucrose content. The intracellular localization of ScUGPase-1 indicated partial membrane association of this soluble protein in both the leaves and internodes. Using a phospho-specific antibody, we observed that ScUGPase-1 was phosphorylated in vivo at the Ser-419 site in the soluble and membrane fractions from the leaves but not from the internodes. The purified recombinant enzyme was kinetically characterized in the direction of UDP-glucose formation, and the enzyme activity was affected by redox modification. Preincubation with H2O2 strongly inhibited this activity, which could be reversed by DTT. Small angle x-ray scattering analysis indicated that the dimer interface is located at the C terminus and provided the first structural model of the dimer of sugarcane UGPase in solution.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Sugarcane holds an important place in the Brazilian economy. Grate part of the sugarcane harvested still accomplished largely manually. Sugarcane harvesters available in Brazil use the technology to chop the cane into 200 to 300 mm billets to allow on the go cane transferring to transport, contradicting the traditional method of whole stalk sugarcane harvesting system. In order to make whole stalk mechanical harvesting system possible, one of the barriers to be expired is the mechanical removal of the straw. The design of a mechanism that accomplishes this operation depends directly on the knowledge of the mechanical properties of the sugarcane related to its resistance to compression and the forces necessary to remove the leaves from the stalk. Compression tests were conducted using the universal testing machine. For leaves removal test by friction, a special apparatus was designed to allow the registration of the normal and traction force. The sugarcane stalk can resist up to 4.9 MPa. With a normal pressure of 0.8 MPa, which correspond to a friction force of 315 N, it is possible to remove the leaves, independent of its location in the sugarcane stalk.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This research studied the effect of low density polyethylene packaging and storage temperature on the preservation of fresh-cut (minimally processed) cabbage. The cabbages, previously cooled to a temperature of 10 ºC, were selected, washed, cut in four parts (with the central stalk removed), sanitized, cut in strips, rinsed, put in the centrifuge, weighed and stored in plastic packaging of low density polyethylene (70 µm), and then stored in cold chambers at temperatures of 1 and 10 ºC for 20 days. The following aspects were evaluated: carbon dioxide, oxygen and ethylene in the internal atmosphere of the package as well as, pH, titratable acidity, total soluble solids, vitamin C, loss of fresh mass and the total soluble solids/acidity in the fresh-cut cabbage ratio. The experimental design was entirely casual, with three repetitions. The analysis parameters, except for the vitamin C, loss of fresh mass and ethylene, presented significant variation between the temperatures and days of storage. The cabbage stored at a temperature of 1 ºC presented a shelf life of around 15 days, significantly higher than that stored at 10 ºC. At this temperature, on the 8th day of storage, the product was completely decayed, unfit for commercialization or consumption.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física