Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Reduced Insulin Clearance And Lower Insulin-degrading Enzyme Expression In The Liver Might Contribute To The Thrifty Phenotype Of Protein-restricted Mice.

Nutrient restriction during the early stages of life usually leads to alterations in glucose homeostasis, mainly insulin secretion and sensitivity, increasing the risk of metabolic disorders in adulthood. Despite growing evidence regarding the importance of insulin clearance during glucose homeostasis in health and disease, no information exists about this process in malnourished animals. Thus, in the present study, we aimed to determine the effect of a nutrient-restricted diet on insulin clearance using a model in which 30-d-old C57BL/6 mice were exposed to a protein-restricted diet for 14 weeks. After this period, we evaluated many metabolic variables and extracted pancreatic islet, liver, gastrocnemius muscle (GCK) and white adipose tissue samples from the control (normal-protein diet) and restricted (low-protein diet, LP) mice. Insulin concentrations were determined using RIA and protein expression and phosphorylation by Western blot analysis. The LP mice exhibited lower body weight, glycaemia, and insulinaemia, increased glucose tolerance and altered insulin dynamics after the glucose challenge. The improved glucose tolerance could partially be explained by an increase in insulin sensitivity through the phosphorylation of the insulin receptor/protein kinase B and AMP-activated protein kinase/acetyl-CoA carboxylase in the liver, whereas the changes in insulin dynamics could be attributed to reduced insulin secretion coupled with reduced insulin clearance and lower insulin-degrading enzyme (IDE) expression in the liver and GCK. In summary, protein-restricted mice not only produce and secrete less insulin, but also remove and degrade less insulin. This phenomenon has the double benefit of sparing insulin while prolonging and potentiating its effects, probably due to the lower expression of IDE in the liver, possibly with long-term consequences.