As conferências nacionais do esporte na configuração da política esportiva e de lazer no governo Lula (2003-2010)

Universidade Estadual de Campinas . Faculdade de Educação Física

Is Sport Practice A Risk Factor For Shoulder Injuries In Tetraplegic Individuals?

A retrospective cohort. To report the incidence rates of shoulder injuries diagnosed with magnetic resonance imaging (MRI) in tetraplegic athletes and sedentary tetraplegic individuals. To evaluate whether sport practice increases the risk of shoulder injuries in tetraplegic individuals. Campinas, Sao Paulo, Brazil. Ten tetraplegic athletes with traumatic spinal cord injury were selected among quad rugby athletes and had both the shoulders evaluated by MRI. They were compared with 10 sedentary tetraplegic individuals who were submitted to the same radiological protocol. All athletes were male with a mean age of 32.1 years (range 25-44 years, s.d.=6.44). Time since injury ranged from 6 to 17 years, with a mean value of 9.7 years and s.d. of 3.1 years. All sedentary individuals were male with a mean age of 35.9 years (range 22-47 years, s.d.=8.36). Statistical analysis showed a protective effect of sport in the development of shoulder injuries, with a weak correlation for infraspinatus and subscapularis tendinopathy (P=0.09 and P=0.08, respectively) and muscle atrophy (P=0.08). There was a strong correlation for acromioclavicular joint (ACJ) and labrum injuries (P=0.04), with sedentary individuals at a higher risk for these injuries. Tetraplegic athletes and sedentary individuals have a high incidence of supraspinatus tendinosis, bursitis and ACJ degeneration. Statistical analysis showed that there is a possible protective effect of sport in the development of shoulder injuries. Weak evidence was encountered for infraspinatus and subscapularis tendinopathy and muscle atrophy (P=0.09, P=0.08 and P=0.08, respectively). Strong evidence with P=0.04 suggests that sedentary tetraplegic individuals are at a greater risk for ACJ and labrum injuries.Spinal Cord advance online publication, 17 March 2015; doi:10.1038/sc.2014.248.

Otimização das condições de produção de ésteres etílicos a partir de óleo de peixe com elevado teor de ácidos graxos ômega-3

The production of ethyl esters by alcoholysis is an alternative for splitting triacylglycerols due to the possibility of using low temperatures, which results in oxidative protection of the polyunsaturated fatty acids. Ethyl esters produced under mild conditions of temperature could be used as substrate for obtaining structured lipids. The reaction parameters of production of ethyl esters from fish oil with high content of omega-3 fatty acids by alcoholysis were optimized using response surface methodology. An experimental design (2³) (with levels +1 and -1, six axial points with levels -alpha and +alpha and three central points) was applied. The variables investigated were concentration of catalyst, amount of ethyl alcohol and temperature. Ethyl ester conversion was monitored by high performance size exclusion chromatography (HPSEC) and the best result obtained was 95% conversion rate. The optimal conditions were 40 °C, 1% of NaOH and 36% of ethanol.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Realidade da olimpíada colegial do estado de São Paulo (OCESP) em relação ao discurso presente na educação física acerca da competição escolar : estudo da região leste de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

O rugbi em cadeira de rodas : aspectos tecnicos e taticos e diretrizes para seu desenvolvimento

Universidade Estadual de Campinas . Faculdade de Educação Física

Perfil antropometrico e desempenho fisico-motor de crianças e jovens com deficiencia visual participantes do atletismo nos 1. Jogos Escolares da Confederação Brasileira de Desportos para Cegos

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol : Analises qualitativas e quantitativas para verificação e modulação de padrões e sistemas complexos de jogo

Universidade Estadual de Campinas . Faculdade de Educação Física

Ginastica de Grande Area : uma realidade possivel no contexto escolar

Universidade Estadual de Campinas. Faculdade de Educação Física

Pedagogia do treinamento : metodo, procedimentos pedagogicos e as multiplas competencias do tecnico nos jogos desportivos coletivos

Universidade Estadual de Campinas. Faculdade de Educação Física

Um estudo das políticas públicas de lazer de Brotas/SP = : Brotas leisure public policies, São Paulo State

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia do esporte : organização, sistematização, aplicação e avaliação de conteúdos esportivos na educação não formal = Sport pedagogy : organization, systematization and application of sports content in non-formal education

Universidade Estadual de Campinas . Faculdade de Educação Física

O setor privado sem fins lucrativos e as políticas públicas de esporte e lazer (2008-2011) = : The non-profitable private sector and the public policies for sport and leisure (2008-2011)

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento de ferramentas de análise de desempenho de atletas em 3 diferentes modalidades : Handebol, Provas Combinadas e Salto com Vara

Universidade Estadual de Campinas. Faculdade de Educação Física