33 resultados para Specific values

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Garlic is a spice and a medicinal plant; hence, there is an increasing interest in 'developing' new varieties with different culinary properties or with high content of nutraceutical compounds. Phenotypic traits and dominant molecular markers are predominantly used to evaluate the genetic diversity of garlic clones. However, 24 SSR markers (codominant) specific for garlic are available in the literature, fostering germplasm researches. In this study, we genotyped 130 garlic accessions from Brazil and abroad using 17 polymorphic SSR markers to assess the genetic diversity and structure. This is the first attempt to evaluate a large set of accessions maintained by Brazilian institutions. A high level of redundancy was detected in the collection (50 % of the accessions represented eight haplotypes). However, non-redundant accessions presented high genetic diversity. We detected on average five alleles per locus, Shannon index of 1.2, HO of 0.5, and HE of 0.6. A core collection was set with 17 accessions, covering 100 % of the alleles with minimum redundancy. Overall FST and D values indicate a strong genetic structure within accessions. Two major groups identified by both model-based (Bayesian approach) and hierarchical clustering (UPGMA dendrogram) techniques were coherent with the classification of accessions according to maturity time (growth cycle): early-late and midseason accessions. Assessing genetic diversity and structure of garlic collections is the first step towards an efficient management and conservation of accessions in genebanks, as well as to advance future genetic studies and improvement of garlic worldwide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Atomic charge transfer-counter polarization effects determine most of the infrared fundamental CH intensities of simple hydrocarbons, methane, ethylene, ethane, propyne, cyclopropane and allene. The quantum theory of atoms in molecules/charge-charge flux-dipole flux model predicted the values of 30 CH intensities ranging from 0 to 123 km mol(-1) with a root mean square (rms) error of only 4.2 km mol(-1) without including a specific equilibrium atomic charge term. Sums of the contributions from terms involving charge flux and/or dipole flux averaged 20.3 km mol(-1), about ten times larger than the average charge contribution of 2.0 km mol(-1). The only notable exceptions are the CH stretching and bending intensities of acetylene and two of the propyne vibrations for hydrogens bound to sp hybridized carbon atoms. Calculations were carried out at four quantum levels, MP2/6-311++G(3d,3p), MP2/cc-pVTZ, QCISD/6-311++G(3d,3p) and QCISD/cc-pVTZ. The results calculated at the QCISD level are the most accurate among the four with root mean square errors of 4.7 and 5.0 km mol(-1) for the 6-311++G(3d,3p) and cc-pVTZ basis sets. These values are close to the estimated aggregate experimental error of the hydrocarbon intensities, 4.0 km mol(-1). The atomic charge transfer-counter polarization effect is much larger than the charge effect for the results of all four quantum levels. Charge transfer-counter polarization effects are expected to also be important in vibrations of more polar molecules for which equilibrium charge contributions can be large.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

THE PURPOSE OF THIS STUDY WAS TO PROPOSE A SPECIFIC LACTATE MINIMUM TEST FOR ELITE BASKETBALL PLAYERS CONSIDERING THE: Running Anaerobic Sprint Test (RAST) as a hyperlactatemia inductor, short distances (specific distance, 20 m) during progressive intensity and mathematical analysis to interpret aerobic and anaerobic variables. The basketball players were assigned to four groups: All positions (n=26), Guard (n= 7), Forward (n=11) and Center (n=8). The hyperlactatemia elevation (RAST) method consisted of 6 maximum sprints over 35 m separated by 10 s of recovery. The progressive phase of the lactate minimum test consisted of 5 stages controlled by an electronic metronome (8.0, 9.0, 10.0, 11.0 and 12.0 km/h) over a 20 m distance. The RAST variables and the lactate values were analyzed using visual and mathematical models. The intensity of the lactate minimum test, determined by a visual method, reduced in relation to polynomial fits (2nd degree) for the Small Forward positions and General groups. The Power and Fatigue Index values, determined by both methods, visual and 3rd degree polynomial, were not significantly different between the groups. In conclusion, the RAST is an excellent hyperlactatemia inductor and the progressive intensity of lactate minimum test using short distances (20 m) can be specifically used to evaluate the aerobic capacity of basketball players. In addition, no differences were observed between the visual and polynomial methods for RAST variables, but lactate minimum intensity was influenced by the method of analysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate the microtensile bond strength (µTBS) of a fluoride-containing adhesive system submitted to a pH-cycling and storage time regimen for primary outcomes. As secondary outcomes the fluoride released amount was evaluated. Twelve dentin surfaces from sound third molar were divided into 2 groups according to adhesive systems: Clearfil SE Protect (PB) and Clearfil SE Bond (SE). Sticks obtained (1.0 mm2) from teeth were randomly divided into 3 subgroups according to storage regimen model: immediate (24h); 5-month deionized water (W); and pH-cycling model (C). All sticks were tested for µTBS in a universal testing machine. Fluoride concentration was obtained from 1-4 days and 30-day in W and 1-4 days in demineralization (DE)/remineralization (RE) solutions from C, using a fluoride-specific electrode. µTBS and fluoride released data were, respectively, submitted to ANOVA in a split plot design and Tukey, and Friedman' tests (a=0.05). There was no significant interaction between adhesive system and storage regimen for µTBS. W showed the lowest µTBS values. There was no significant difference between 24 h and C models for µTBS. There was no significant difference between adhesive systems. Failure mode was predominantly cohesive within composite for the 24 h and W, for the C group it was mixed for SE and cohesive within composite for PB adhesive system. Fluoride concentrations in the DE/RE solutions were less than 0.03125 ppm and not detected in W. In conclusion, the fluoride-containing adhesive system performed similarly to the regular one. Hydrolytic degradation is the main problem with both adhesive systems, regardless of fluoride contents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nutrients composition, phenolic compounds, antioxidant activity and estimated glycemic index (EGI) were evaluated in sorghum bran (SB) and decorticated sorghum flour (DSF), obtained by a rice-polisher, as well as whole sorghum flour (WSF). Correlation between EGI and the studied parameters were determined. SB presented the highest protein, lipid, ash, β-glucan, total and insoluble dietary fiber contents; and the lowest non-resistant and total starch contents. The highest carbohydrate and resistant starch contents were in DSF and WSF, respectively. Phenolic compounds and antioxidant activities were concentrated in SB. The EGI values were: DSF 84.5±0.41; WSF 77.2±0.33; and SB 60.3±0.78. Phenolic compounds, specific flavonoids and antioxidant activities, as well as total, insoluble and soluble dietary fiber and β-glucans of sorghum flour samples were all negatively correlated to EGI. RS content was not correlated to EGI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Brazil is an important poultry meat export country, and large parts of its destination are countries with specific rearing restrictions related to broiler s welfare. One of the aerial pollutants mostly found in high concentrations in closed poultry housing environment is ammonia. There are evidences that broilers welfare may be compromised by the continuous exposition to this pollutant in rearing housing. This research aimed to estimate broilers welfare reared under specific thermal environmental attributes and bird s density, as function of the ammonia concentration and light intensity inside the housing environment using the Fuzzy Theory. Results showed that the best welfare value (0.89 in the scale: 0-1) approximately 90% of the ideal was found in the conditions that associated the ideal thermal environment, with bird s density between 13-15 birds m-2, with values of the ammonia concentration in the environment below 5 ppm, and light intensity near 1 lx. Using the predictive method it was possible to estimate broilers welfare with relation to the ammonia concentration and light intensity in the housing.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física