Condutividade e difusividade térmica do figo (Ficus carica L.) Roxo de Valinhos

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

The Effect Of Celastrol, A Triterpene With Antitumorigenic Activity, On Conformational And Functional Aspects Of The Human 90kda Heat Shock Protein Hsp90α, A Chaperone Implicated In The Stabilization Of The Tumor Phenotype.

Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.