Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Low-density Lipoprotein Cholesterol And Radiotherapy-induced Carotid Atherosclerosis In Subjects With Head And Neck Cancer.

Radiotherapy (RT) is a risk factor for accelerated carotid artery atherosclerotic disease in subjects with head and neck cancer. However, the risk factors of RT-induced carotid artery remodeling are not established. This study aimed to investigate the effects of RT on carotid and popliteal arteries in subjects with head and neck cancer and to evaluate the relationship between baseline clinical and laboratory features and the progression of RT-induced atherosclerosis. Eleven men (age = 57.9 ± 6.2years) with head and neck cancer who underwent cervical bilateral irradiation were prospectively examined by clinical and laboratory analysis and by carotid and popliteal ultrasound before and after treatment (mean interval between the end of RT and the post-RT assessment = 181 ± 47 days). No studied subject used hypocholesterolemic medications. Significant increases in carotid intima-media thickness (IMT) (0.95 ± 0.08 vs. 0.87 ± 0.05 mm; p < 0.0001) and carotid IMT/diameter ratio (0.138 ± 0.013 vs. 0.129 ± 0.014; p = 0.001) were observed after RT, while no changes in popliteal structural features were detected. In addition, baseline low-density lipoprotein cholesterol levels showed a direct correlation with RT-induced carotid IMT change (r = 0.66; p = 0.027), while no other studied variable exhibited a significant relationship with carotid IMT change. These results indicate that RT-induced atherosclerosis is limited to the irradiated area and also suggest that it may be predicted by low-density lipoprotein cholesterol levels in subjects with head and neck cancer.

Exploratory Study Of The Effect Of Lifestyle Counselling On Bone Mineral Density And Body Composition In Users Of The Contraceptive Depot-medroxyprogesterone Acetate.

To compare variations in bone mineral density (BMD) and body composition (BC) in depot-medroxyprogesterone acetate (DMPA) users and nonusers after providing counselling on healthy lifestyle habits. An exploratory study in which women aged 18 to 40 years participated: 29 new DMPA users and 25 new non-hormonal contraceptive users. All participants were advised on healthy lifestyle habits: sun exposure, walking and calcium intake. BMD and BC were assessed at baseline and 12 months later. Statistical analysis included the Mann-Whitney test or Student's t-test followed by multiple linear regression analysis. Compared to the controls, DMPA users had lower BMD at vertebrae L1 and L4 after 12 months of use. They also had a mean increase of 2 kg in total fat mass and an increase of 2.2% in body fat compared to the non-hormonal contraceptive users. BMD loss at L1 was less pronounced in DMPA users with a calcium intake ≥ 1 g/day compared to DMPA users with a lower calcium intake. DMPA use was apparently associated with lower BMD and an increase in fat mass at 12 months of use. Calcium intake ≥ 1 g/day attenuates BMD loss in DMPA users. Counselling on healthy lifestyle habits failed to achieve its aims.

Low-density Three-dimensional Foam Using Self-reinforced Hybrid Two-dimensional Atomic Layers.

Low-density nanostructured foams are often limited in applications due to their low mechanical and thermal stabilities. Here we report an approach of building the structural units of three-dimensional (3D) foams using hybrid two-dimensional (2D) atomic layers made of stacked graphene oxide layers reinforced with conformal hexagonal boron nitride (h-BN) platelets. The ultra-low density (1/400 times density of graphite) 3D porous structures are scalably synthesized using solution processing method. A layered 3D foam structure forms due to presence of h-BN and significant improvements in the mechanical properties are observed for the hybrid foam structures, over a range of temperatures, compared with pristine graphene oxide or reduced graphene oxide foams. It is found that domains of h-BN layers on the graphene oxide framework help to reinforce the 2D structural units, providing the observed improvement in mechanical integrity of the 3D foam structure.

Molecular Variations In Aromatic Cosolutes: Critical Role In The Rheology Of Cationic Wormlike Micelles.

Wormlike micelles formed by the addition to cetyltrimethylammonium bromide (CTAB) of a range of aromatic cosolutes with small molecular variations in their structure were systematically studied. Phenol and derivatives of benzoate and cinnamate were used, and the resulting mixtures were studied by oscillatory, steady-shear rheology, and the microstructure was probed by small-angle neutron scattering. The lengthening of the micelles and their entanglement result in remarkable viscoelastic properties, making rheology a useful tool to assess the effect of structural variations of the cosolutes on wormlike micelle formation. For a fixed concentration of CTAB and cosolute (200 mmol L(-1)), the relaxation time decreases in the following order: phenol > cinnamate> o-hydroxycinnamate > salicylate > o-methoxycinnamate > benzoate > o-methoxybenzoate. The variations in viscoelastic response are rationalized by using Mulliken population analysis to map out the electronic density of the cosolutes and quantify the barrier to rotation of specific groups on the aromatics. We find that the ability of the group attached to the aromatic ring to rotate is crucial in determining the packing of the cosolute at the micellar interface and thus critically impacts the micellar growth and, in turn, the rheological response. These results enable us for the first time to propose design rules for the self-assembly of the surfactants and cosolutes resulting in the formation of wormlike micelles with the cationic surfactant CTAB.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Reference Values For High-density Lipoprotein Particle Size And Volume By Dynamic Light Scattering In A Brazilian Population Sample And Their Relationships With Metabolic Parameters.

Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.

The Metabolic Syndrome And Sexual Function In Climacteric Women: A Cross-sectional Study.

Studies have associated the metabolic syndrome with poor sexual function; the results, however, are controversial. To evaluate the relationship between the metabolic syndrome and sexual function and to identify the factors associated with poor sexual function. A secondary analysis of a cross-sectional cohort study including 256 women of 40-60 years of age receiving care at the outpatient department of a university teaching hospital. A specific questionnaire was applied to collect sociodemographic and behavioral data, and the Short Personal Experience Questionnaire was used to evaluate sexual function, with a score ≤ 7 being indicative of poor sexual function. Anthropometric measurements, blood pressure, fasting glucose, high-density lipoprotein, total cholesterol, triglycerides, follicle-stimulating hormone and thyroid stimulating hormone levels were determined. The prevalence of the metabolic syndrome, as defined by the International Diabetes Federation, was 62.1%, and the prevalence of poor sexual function was 31.4%. The only factor related to female sexual function that was associated with the metabolic syndrome was sexual dysfunction in the woman's partner. The factors associated with poor sexual function in the bivariate analysis were age >50 years (P=0.003), not having a partner (P<0.001), being postmenopausal (P=0.046), the presence of hot flashes (P=0.02), poor self-perception of health (P=0.04), partner's age ≥ 50 years, and time with partner ≥ 21 years. Reported active (P=0.02) and passive (P=0.01) oral sex was associated with an absence of sexual dysfunction. In the multiple regression analysis, the only factor associated with poor sexual function was being 50 years of age or more. The prevalence of the metabolic syndrome was high and was not associated with poor sexual function in this sample of menopausal women. The only factor associated with poor sexual function was being over 50 years of age.

Condutividade e difusividade térmica do figo (Ficus carica L.) Roxo de Valinhos

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Estimativa de bem-estar de frango de corte em função da concentração de amônia e grau de luminosidade no galpão de produção

Brazil is an important poultry meat export country, and large parts of its destination are countries with specific rearing restrictions related to broiler s welfare. One of the aerial pollutants mostly found in high concentrations in closed poultry housing environment is ammonia. There are evidences that broilers welfare may be compromised by the continuous exposition to this pollutant in rearing housing. This research aimed to estimate broilers welfare reared under specific thermal environmental attributes and bird s density, as function of the ammonia concentration and light intensity inside the housing environment using the Fuzzy Theory. Results showed that the best welfare value (0.89 in the scale: 0-1) approximately 90% of the ideal was found in the conditions that associated the ideal thermal environment, with bird s density between 13-15 birds m-2, with values of the ammonia concentration in the environment below 5 ppm, and light intensity near 1 lx. Using the predictive method it was possible to estimate broilers welfare with relation to the ammonia concentration and light intensity in the housing.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.