Beam-energy Dependence Of The Directed Flow Of Protons, Antiprotons, And Pions In Au+au Collisions.

Rapidity-odd directed flow (v1) measurements for charged pions, protons, and antiprotons near midrapidity (y=0) are reported in sNN=7.7, 11.5, 19.6, 27, 39, 62.4, and 200 GeV Au+Au collisions as recorded by the STAR detector at the Relativistic Heavy Ion Collider. At intermediate impact parameters, the proton and net-proton slope parameter dv1/dy|y=0 shows a minimum between 11.5 and 19.6 GeV. In addition, the net-proton dv1/dy|y=0 changes sign twice between 7.7 and 39 GeV. The proton and net-proton results qualitatively resemble predictions of a hydrodynamic model with a first-order phase transition from hadronic matter to deconfined matter, and differ from hadronic transport calculations.

Hypothalamic Inflammation And The Central Nervous System Control Of Energy Homeostasis.

The control of energy homeostasis relies on robust neuronal circuits that regulate food intake and energy expenditure. Although the physiology of these circuits is well understood, the molecular and cellular response of this program to chronic diseases is still largely unclear. Hypothalamic inflammation has emerged as a major driver of energy homeostasis dysfunction in both obesity and anorexia. Importantly, this inflammation disrupts the action of metabolic signals promoting anabolism or supporting catabolism. In this review, we address the evidence that favors hypothalamic inflammation as a factor that resets energy homeostasis in pathological states.

Beam-energy Dependence Of Charge Separation Along The Magnetic Field In Au+au Collisions At Rhic.

Local parity-odd domains are theorized to form inside a quark-gluon plasma which has been produced in high-energy heavy-ion collisions. The local parity-odd domains manifest themselves as charge separation along the magnetic field axis via the chiral magnetic effect. The experimental observation of charge separation has previously been reported for heavy-ion collisions at the top RHIC energies. In this Letter, we present the results of the beam-energy dependence of the charge correlations in Au+Au collisions at midrapidity for center-of-mass energies of 7.7, 11.5, 19.6, 27, 39, and 62.4 GeV from the STAR experiment. After background subtraction, the signal gradually reduces with decreased beam energy and tends to vanish by 7.7 GeV. This implies the dominance of hadronic interactions over partonic ones at lower collision energies.

Propylthiouracil Quantification In Human Plasma By High-performance Liquid Chromatography Coupled With Electrospray Tandem Mass Spectrometry: Application In A Bioequivalence Study.

A rapid, sensitive and specific method for quantifying propylthiouracil in human plasma using methylthiouracil as the internal standard (IS) is described. The analyte and the IS were extracted from plasma by liquid-liquid extraction using an organic solvent (ethyl acetate). The extracts were analyzed by high performance liquid chromatography coupled with electrospray tandem mass spectrometry (HPLC-MS/MS) in negative mode (ES-). Chromatography was performed using a Phenomenex Gemini C18 5μm analytical column (4.6mm×150mm i.d.) and a mobile phase consisting of methanol/water/acetonitrile (40/40/20, v/v/v)+0.1% of formic acid. For propylthiouracil and I.S., the optimized parameters of the declustering potential, collision energy and collision exit potential were -60 (V), -26 (eV) and -5 (V), respectively. The method had a chromatographic run time of 2.5min and a linear calibration curve over the range 20-5000ng/mL. The limit of quantification was 20ng/mL. The stability tests indicated no significant degradation. This HPLC-MS/MS procedure was used to assess the bioequivalence of two propylthiouracil 100mg tablet formulations in healthy volunteers of both sexes in fasted and fed state. The geometric mean and 90% confidence interval CI of Test/Reference percent ratios were, without and with food, respectively: 109.28% (103.63-115.25%) and 115.60% (109.03-122.58%) for Cmax, 103.31% (100.74-105.96%) and 103.40% (101.03-105.84) for AUClast. This method offers advantages over those previously reported, in terms of both a simple liquid-liquid extraction without clean-up procedures, as well as a faster run time (2.5min). The LOQ of 20ng/mL is well suited for pharmacokinetic studies. The assay performance results indicate that the method is precise and accurate enough for the routine determination of the propylthiouracil in human plasma. The test formulation with and without food was bioequivalent to reference formulation. Food administration increased the Tmax and decreased the bioavailability (Cmax and AUC).

Rapidly Switching Multidirectional Defibrillation: Reversal Of Ventricular Fibrillation With Lower Energy Shocks.

Cardiac arrest after open surgery has an incidence of approximately 3%, of which more than 50% of the cases are due to ventricular fibrillation. Electrical defibrillation is the most effective therapy for terminating cardiac arrhythmias associated with unstable hemodynamics. The excitation threshold of myocardial microstructures is lower when external electrical fields are applied in the longitudinal direction with respect to the major axis of cells. However, in the heart, cell bundles are disposed in several directions. Improved myocardial excitation and defibrillation have been achieved by applying shocks in multiple directions via intracardiac leads, but the results are controversial when the electrodes are not located within the cardiac chambers. This study was designed to test whether rapidly switching shock delivery in 3 directions could increase the efficiency of direct defibrillation. A multidirectional defibrillator and paddles bearing 3 electrodes each were developed and used in vivo for the reversal of electrically induced ventricular fibrillation in an anesthetized open-chest swine model. Direct defibrillation was performed by unidirectional and multidirectional shocks applied in an alternating fashion. Survival analysis was used to estimate the relationship between the probability of defibrillation and the shock energy. Compared with shock delivery in a single direction in the same animal population, the shock energy required for multidirectional defibrillation was 20% to 30% lower (P < .05) within a wide range of success probabilities. Rapidly switching multidirectional shock delivery required lower shock energy for ventricular fibrillation termination and may be a safer alternative for restoring cardiac sinus rhythm.

Beam Energy Dependence Of Moments Of The Net-charge Multiplicity Distributions In Au+au Collisions At Rhic.

We report the first measurements of the moments--mean (M), variance (σ(2)), skewness (S), and kurtosis (κ)--of the net-charge multiplicity distributions at midrapidity in Au+Au collisions at seven energies, ranging from sqrt[sNN]=7.7 to 200 GeV, as a part of the Beam Energy Scan program at RHIC. The moments are related to the thermodynamic susceptibilities of net charge, and are sensitive to the location of the QCD critical point. We compare the products of the moments, σ(2)/M, Sσ, and κσ(2), with the expectations from Poisson and negative binomial distributions (NBDs). The Sσ values deviate from the Poisson baseline and are close to the NBD baseline, while the κσ(2) values tend to lie between the two. Within the present uncertainties, our data do not show nonmonotonic behavior as a function of collision energy. These measurements provide a valuable tool to extract the freeze-out parameters in heavy-ion collisions by comparing with theoretical models.

Hypothalamic S1p/s1pr1 Axis Controls Energy Homeostasis.

Sphingosine 1-phosphate receptor 1 (S1PR1) is a G-protein-coupled receptor for sphingosine-1-phosphate (S1P) that has a role in many physiological and pathophysiological processes. Here we show that the S1P/S1PR1 signalling pathway in hypothalamic neurons regulates energy homeostasis in rodents. We demonstrate that S1PR1 protein is highly enriched in hypothalamic POMC neurons of rats. Intracerebroventricular injections of the bioactive lipid, S1P, reduce food consumption and increase rat energy expenditure through persistent activation of STAT3 and the melanocortin system. Similarly, the selective disruption of hypothalamic S1PR1 increases food intake and reduces the respiratory exchange ratio. We further show that STAT3 controls S1PR1 expression in neurons via a positive feedback mechanism. Interestingly, several models of obesity and cancer anorexia display an imbalance of hypothalamic S1P/S1PR1/STAT3 axis, whereas pharmacological intervention ameliorates these phenotypes. Taken together, our data demonstrate that the neuronal S1P/S1PR1/STAT3 signalling axis plays a critical role in the control of energy homeostasis in rats.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Sistematização do dimensionamento técnico e econômico de sistemas fotovoltaicos isolados por meio de programa computacional

One of the main referring subjects to the solar energy is how to compare it economically with other sources of energy, as much alternatives as with conventionals (like the electric grid). The purpose of this work was to develop a software which congregates the technical and economic main data to identify, through methods of microeconomic analysis, the commercial viability in the sizing of photovoltaic systems, besides considering the benefits proceeding from the proper energy generation. Considering the period of useful life of the components of the generation system of photovoltaic electricity, the costs of the energy proceeding from the conventional grid had been identified. For the comparison of the conventional sources, electric grid and diesel generation, three scenes of costs of photovoltaic panels and two for the factor of availability of diesel generation had been used. The results have shown that if the cost of the panels is low and the place of installation is more distant of the electric grid, the photovoltaic system becomes the best option.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Estudo da postura corporal e aspectos nutricionais em escolares do ensino fundamental da rede publica

Universidade Estadual de Campinas. Faculdade de Educação Física

Exercicios fisicos na melhoria da qualidade de vida e da capacidade de trabalho e na prevenção da dor e da fadiga, entre trabalhadores de fabrica

Universidade Estadual de Campinas. Faculdade de Educação Física