10 resultados para South American Indigenous peoples
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
In order to report the outcome of a patient who developed compartment syndrome after South American rattlesnake (Crotalus durissus terrificus) envenomation, confirmed by subfascial pressure measurement and magnetic resonance imaging (MRI). A 63-year-old male was admitted 1 h after being bitten on the right elbow by a large snake, which was not brought for identification. Physical and laboratory features upon admission revealed two fang marks, local tense swelling, paresthesia, intense local pain, hypertension, coagulopathy, and CK = 1530 U/L (RV < 170 U/L). The case was initially treated with bothropic antivenom (80 mL, intravenously), with no improvement. Evolution within 13-14 h post-bite revealed generalized myalgia, muscle weakness, palpebral ptosis, and severe rhabdomyolysis (CK = 126,160 U/L) compatible with envenoming by C. d. terrificus. The patient was then treated with crotalic antivenom (200 mL, intravenously), fluid replacement, and urine alkalinization. Twenty-four-hour post-bite MRI showed marked muscular edema in the anterior compartment of the right forearm, with a high subfascial pressure (40 mmHg) being detected 1 h later. ELISA of a blood sample obtained upon admission, before antivenom infusion, revealed a high serum concentration of C. d. terrificus venom. No fasciotomy was performed and the patient was discharged seven days later without sequelae. Snakebite by C. d. terrificus with subfascial venom injection may lead to increased intracompartmental pressure.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
In this study, 103 unrelated South-American patients with mucopolysaccharidosis type II (MPS II) were investigated aiming at the identification of iduronate-2-sulfatase (IDS) disease causing mutations and the possibility of some insights on the genotype-phenotype correlation The strategy used for genotyping involved the identification of the previously reported inversion/disruption of the IDS gene by PCR and screening for other mutations by PCR/SSCP. The exons with altered mobility on SSCP were sequenced, as well as all the exons of patients with no SSCP alteration. By using this strategy, we were able to find the pathogenic mutation in all patients. Alterations such as inversion/disruption and partial/total deletions of the IDS gene were found in 20/103 (19%) patients. Small insertions/deletions/indels (<22 bp) and point mutations were identified in 83/103 (88%) patients, including 30 novel mutations; except for a higher frequency of small duplications in relation to small deletions, the frequencies of major and minor alterations found in our sample are in accordance with those described in the literature.
Resumo:
New DNA-based predictive tests for physical characteristics and inference of ancestry are highly informative tools that are being increasingly used in forensic genetic analysis. Two eye colour prediction models: a Bayesian classifier - Snipper and a multinomial logistic regression (MLR) system for the Irisplex assay, have been described for the analysis of unadmixed European populations. Since multiple SNPs in combination contribute in varying degrees to eye colour predictability in Europeans, it is likely that these predictive tests will perform in different ways amongst admixed populations that have European co-ancestry, compared to unadmixed Europeans. In this study we examined 99 individuals from two admixed South American populations comparing eye colour versus ancestry in order to reveal a direct correlation of light eye colour phenotypes with European co-ancestry in admixed individuals. Additionally, eye colour prediction following six prediction models, using varying numbers of SNPs and based on Snipper and MLR, were applied to the study populations. Furthermore, patterns of eye colour prediction have been inferred for a set of publicly available admixed and globally distributed populations from the HGDP-CEPH panel and 1000 Genomes databases with a special emphasis on admixed American populations similar to those of the study samples.
Resumo:
Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.
Resumo:
Crotamine is one of the main constituents of the venom of the South American rattlesnake Crotalus durissus terrificus. Here we sought to investigate the inflammatory and toxicological effects induced by the intrahippocampal administration of crotamine isolated from Crotalus whole venom. Adult rats received an intrahippocampal infusion of crotamine or vehicle and were euthanized 24 h or 21 days after infusion. Plasma and brain tissue were collected for biochemical analysis. Complete blood count, creatinine, urea, glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), creatine-kinase (CK), creatine kinase-muscle B (CK-MB) and oxidative parameters (assessed by DNA damage and micronucleus frequency in leukocytes, lipid peroxidation and protein carbonyls in plasma and brain) were quantified. Unpaired and paired t-tests were used for comparisons between saline and crotamine groups, and within groups (24 h vs. 21 days), respectively. After 24 h crotamine infusion promoted an increase of urea, GOT, GPT, CK, and platelets values (p ≤ 0.01), while red blood cells, hematocrit and leukocytes values decreased (p ≤ 0.01). Additionally, 21 days after infusion crotamine group showed increased creatinine, leukocytes, TBARS (plasma and brain), carbonyl (plasma and brain) and micronucleus compared to the saline-group (p ≤ 0.01). Our findings show that crotamine infusion alter hematological parameters and cardiac markers, as well as oxidative parameters, not only in the brain, but also in the blood, indicating a systemic pro-inflammatory and toxicological activity. A further scientific attempt in terms of preserving the beneficial activity over toxicity is required.
Resumo:
In Myrocarpus, an exclusively South American genus, five species are recognised: Myrocarpus frondosus Allemão, M. leprosus Pickel, M. venezuelensis Rudd, M. fastigiatus Allemãoand M. emarginatus A.L.B. Sartori & A.M.G. Azevedo. Morphologic data, habitat information and geographic distribution of each taxon are discussed. Petal morphology and ornamentation of seed chamber are an important character for species identification, though not shown previously. Key to the species, descriptions, illustrations, distribution, and new registers are presented.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física