13 resultados para Soil formation
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Mine drainage is an important environmental disturbance that affects the chemical and biological components in natural resources. However, little is known about the effects of neutral mine drainage on the soil bacteria community. Here, a high-throughput 16S rDNA pyrosequencing approach was used to evaluate differences in composition, structure, and diversity of bacteria communities in samples from a neutral drainage channel, and soil next to the channel, at the Sossego copper mine in Brazil. Advanced statistical analyses were used to explore the relationships between the biological and chemical data. The results showed that the neutral mine drainage caused changes in the composition and structure of the microbial community, but not in its diversity. The Deinococcus/Thermus phylum, especially the Meiothermus genus, was in large part responsible for the differences between the communities, and was positively associated with the presence of copper and other heavy metals in the environmental samples. Other important parameters that influenced the bacterial diversity and composition were the elements potassium, sodium, nickel, and zinc, as well as pH. The findings contribute to the understanding of bacterial diversity in soils impacted by neutral mine drainage, and demonstrate that heavy metals play an important role in shaping the microbial population in mine environments.
Resumo:
Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.
Resumo:
Mining activities pose severe environmental risks worldwide, generating extreme pH conditions and high concentrations of heavy metals, which can have major impacts on the survival of organisms. In this work, pyrosequencing of the V3 region of the 16S rDNA was used to analyze the bacterial communities in soil samples from a Brazilian copper mine. For the analysis, soil samples were collected from the slopes (geotechnical structures) and the surrounding drainage of the Sossego mine (comprising the Sossego and Sequeirinho deposits). The results revealed complex bacterial diversity, and there was no influence of deposit geographic location on the composition of the communities. However, the environment type played an important role in bacterial community divergence; the composition and frequency of OTUs in the slope samples were different from those of the surrounding drainage samples, and Acidobacteria, Chloroflexi, Firmicutes, and Gammaproteobacteria were responsible for the observed difference. Chemical analysis indicated that both types of sample presented a high metal content, while the amounts of organic matter and water were higher in the surrounding drainage samples. Non-metric multidimensional scaling (N-MDS) analysis identified organic matter and water as important distinguishing factors between the bacterial communities from the two types of mine environment. Although habitat-specific OTUs were found in both environments, they were more abundant in the surrounding drainage samples (around 50 %), and contributed to the higher bacterial diversity found in this habitat. The slope samples were dominated by a smaller number of phyla, especially Firmicutes. The bacterial communities from the slope and surrounding drainage samples were different in structure and composition, and the organic matter and water present in these environments contributed to the observed differences.
Resumo:
In old, phosphorus (P)-impoverished habitats, root specializations such as cluster roots efficiently mobilize and acquire P by releasing large amounts of carboxylates in the rhizosphere. These specialized roots are rarely mycorrhizal. We investigated whether Discocactus placentiformis (Cactaceae), a common species in nutrient-poor campos rupestres over white sands, operates in the same way as other root specializations. Discocactus placentiformis showed no mycorrhizal colonization, but exhibited a sand-binding root specialization with rhizosheath formation. We first provide circumstantial evidence for carboxylate exudation in field material, based on its very high shoot manganese (Mn) concentrations, and then firm evidence, based on exudate analysis. We identified predominantly oxalic acid, but also malic, citric, lactic, succinic, fumaric, and malonic acids. When grown in nutrient solution with P concentrations ranging from 0 to 100 μM, we observed an increase in total carboxylate exudation with decreasing P supply, showing that P deficiency stimulated carboxylate release. Additionally, we tested P solubilization by citric, malic and oxalic acids, and found that they solubilized P from the strongly P-sorbing soil in its native habitat, when the acids were added in combination and in relatively low concentrations. We conclude that the sand-binding root specialization in this nonmycorrhizal cactus functions similar to that of cluster roots, which efficiently enhance P acquisition in other habitats with very low P availability.
Resumo:
A 46-year-old woman complained of blurred and distorted vision in both eyes. Ophthalmic examination showed that visual acuity was 20/200 for the right eye and counting fingers left eye. Fundoscopy revealed perimacular hemorrhages, aneurismal dilatation of the vessels in the posterior pole, and a white and elevated lesion adjacent to vascular changes. We report a case of idiopathic macular telangiectasia and epiretinal membrane that occurs concomitantly. To our knowledge, this is the first report that describes an association between idiopathic macular telangiectasia and epiretinal membrane formation.
Resumo:
99
Resumo:
Silver nanoparticles have attracted considerable attention due to their beneficial properties. But toxicity issues associated with them are also rising. The reports in the past suggested health hazards of silver nanoparticles at the cellular, molecular, or whole organismal level in eukaryotes. Whereas, there is also need to examine the exposure effects of silver nanoparticle to the microbes, which are beneficial to humans as well as environment. The available literature suggests the harmful effects of physically and chemically synthesised silver nanoparticles. The toxicity of biogenically synthesized nanoparticles has been less studied than physically and chemically synthesised nanoparticles. Hence, there is a greater need to study the toxic effects of biologically synthesised silver nanoparticles in general and mycosynthesized nanoparticles in particular. In the present study, attempts have been made to assess the risk associated with the exposure of mycosynthesized silver nanoparticles on a beneficial soil microbe Pseudomonas putida. KT2440. The study demonstrates mycosynthesis of silver nanoparticles and their characterisation by UV-vis spectrophotometry, FTIR, X-ray diffraction, nanosight LM20 - a particle size distribution analyzer and TEM. Silver nanoparticles obtained herein were found to exert the hazardous effect at the concentration of 0.4μg/ml, which warrants further detailed investigations concerning toxicity.
Resumo:
Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.
Resumo:
G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.
Mineral Nutrition Of Campos Rupestres Plant Species On Contrasting Nutrient-impoverished Soil Types.
Resumo:
In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.
Resumo:
Is the carrasco on the Ibiapaba plateau a unique plant formation? To answer this question the vertical height (except of climbers) and the stem basal diameter (from 3cm on) of woody plants were measured, and soil extracts (0-50 and 50-100cm depth) were taken from 100 random plots (10x10m) at Jaburuna (3º54'34S and 40º59'24W, altitudes near 830m), municipality of Ubajara, Ceará State. Data on climate, soil, diameter height, density, basal area, and physiognomy were compared with those surveyed by other researchers from the carrasco, caatinga, and cerrado in Northeastern Brazil. The carrasco occurs under an annual rainfall of between 668 and 1,289mm and temperatures from 22 to 24ºC, on alic Quartz Sand soils, at altitudes between 700 and 900m: it has a larger density and a smaller basal area than the caatinga and the cerrado, small and similar diameters, and an average vertical height between 3,7 and 5,4m. It differs from the caatinga, cerrado (and cerradão) and secondary forest in many items of lhe ecotope, organization and physiognomy, thus being a unique plain formation, which can be characterized as a deciduous, high, closed, and unistratified shrubland intermingled by lianas, with an irregular canopy and sparse, emergent trees.
Resumo:
Several native herbaceous and subshrub species native to the Cerrado in Brazil are geophytes, that is, they survive the unfavorable dry season and low temperatures, that sometimes coincide with fire, with only the underground system intact. Vernonia oxylepis is one of these species and the aim of this study was to describe the morpho-anatomy of the tuberous root and bud formation on this structure. The main axis of this root is perpendicular to the soil surface, and from which aerial shoots arise periodically throughout the life cycle. On the upper portion of the root, self-grafting of the shoots occurs. The root stores lipids and fructans, exhibits contraction and produces reparatory buds; adventitious buds arise from proliferated pericycle. These characteristics may be related to adaptation of this species to conditions in the Cerrado.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.