1. Jogos Escolares Brasileiros da Confederação Brasileira de Desportos para Cegos : um estudo de caso

Universidade Estadual de Campinas . Faculdade de Educação Física

[the Teaching Of Social Sciences In Health: Between Practice And Theory].

The models of teaching social sciences and clinical practice are insufficient for the needs of practical-reflective teaching of social sciences applied to health. The scope of this article is to reflect on the challenges and perspectives of social science education for health professionals. In the 1950s the important movement bringing together social sciences and the field of health began, however weak credentials still prevail. This is due to the low professional status of social scientists in health and the ill-defined position of the social sciences professionals in the health field. It is also due to the scant importance attributed by students to the social sciences, the small number of professionals and the colonization of the social sciences by the biomedical culture in the health field. Thus, the professionals of social sciences applied to health are also faced with the need to build an identity, even after six decades of their presence in the field of health. This is because their ambivalent status has established them as a partial, incomplete and virtual presence, requiring a complex survival strategy in the nebulous area between social sciences and health.

[almost An Autobiography: A Study Of Social Scientists In Health Based On The Lattes Curriculum].

Among the various ways of adopting the biographical approach, we used the curriculum vitaes (CVs) of Brazilian researchers who work as social scientists in health as our research material. These CVs are part of the Lattes Platform of CNPq - the National Council for Scientific and Technological Development, which includes Research and Institutional Directories. We analyzed 238 CVs for this study. The CVs contain, among other things, the following information: professional qualifications, activities and projects, academic production, participation in panels for the evaluation of theses and dissertations, research centers and laboratories and a summarized autobiography. In this work there is a brief review of the importance of autobiography for the social sciences, emphasizing the CV as a form of autobiographical practice. We highlight some results, such as it being a group consisting predominantly of women, graduates in social sciences, anthropology, sociology or political science, with postgraduate degrees. The highest concentration of social scientists is located in Brazil's southern and southeastern regions. In some institutions the main activities of social scientists are as teachers and researchers with great thematic diversity in research.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Finite-element Analysis Of 3 Situations Of Trauma In The Human Edentulous Mandible.

Maxillofacial trauma resulting from falls in elderly patients is a major social and health care concern. Most of these traumatic events involve mandibular fractures. The aim of this study was to analyze stress distributions from traumatic loads applied on the symphyseal, parasymphyseal, and mandibular body regions in the elderly edentulous mandible using finite-element analysis (FEA). Computerized tomographic analysis of an edentulous macerated human mandible of a patient approximately 65 years old was performed. The bone structure was converted into a 3-dimensional stereolithographic model, which was used to construct the computer-aided design (CAD) geometry for FEA. The mechanical properties of cortical and cancellous bone were characterized as isotropic and elastic structures, respectively, in the CAD model. The condyles were constrained to prevent free movement in the x-, y-, and z-axes during simulation. This enabled the simulation to include the presence of masticatory muscles during trauma. Three different simulations were performed. Loads of 700 N were applied perpendicular to the surface of the cortical bone in the symphyseal, parasymphyseal, and mandibular body regions. The simulation results were evaluated according to equivalent von Mises stress distributions. Traumatic load at the symphyseal region generated low stress levels in the mental region and high stress levels in the mandibular neck. Traumatic load at the parasymphyseal region concentrated the resulting stress close to the mental foramen. Traumatic load in the mandibular body generated extensive stress in the mandibular body, angle, and ramus. FEA enabled precise mapping of the stress distribution in a human elderly edentulous mandible (neck and mandibular angle) in response to 3 different traumatic load conditions. This knowledge can help guide emergency responders as they evaluate patients after a traumatic event.

Medication Adherence And Quality Of Life Among The Elderly With Diabetic Retinopathy.

one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Juan César García: Social Medicine As Project And Endeavor.

This paper analyses some aspects of the trajectory of the Argentinian physician and sociologist Juan César García (1932-1984) in the field of Latin American Social Medicine. Three dimensions constituting his basic orientations are highlighted: the elaboration of systematic and reflective social thought; a critical attitude in questioning teaching and professional practices; a commitment to the institutionalization and dissemination of health knowledge.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Brazilian multicentre study of common mental disorders in primary care: rates and related social and demographic factors

Mental health problems are common in primary health care, particularly anxiety and depression. This study aims to estimate the prevalence of common mental disorders and their associations with socio-demographic characteristics in primary care in Brazil (Family Health Strategy). It involved a multicenter cross-sectional study with patients from Rio de Janeiro, São Paulo, Fortaleza (Ceará State) and Porto Alegre (Rio Grande do Sul State), assessed using the General Health Questionnaire (GHQ-12) and the Hospital Anxiety and Depression Scale (HAD). The rate of mental disorders in patients from Rio de Janeiro, São Paulo, Fortaleza and Porto Alegre were found to be, respectively, 51.9%, 53.3%, 64.3% and 57.7% with significant differences between Porto Alegre and Fortaleza compared to Rio de Janeiro after adjusting for confounders. Prevalence proportions of mental problems were especially common for females, the unemployed, those with less education and those with lower incomes. In the context of the Brazilian government's moves towards developing primary health care and reorganizing mental health policies it is relevant to consider common mental disorders as a priority alongside other chronic health conditions.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Identidade social e auto conceito do dançarino em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Procurando o lazer no Constituinte : sua inclusão como direito social na Constituição de 1988

Universidade Estadual de Campinas . Faculdade de Educação Física