6 resultados para Silage - Starch and temperature monitoring
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A-- water bath at 74ºC for 9 h; B-- water bath at 74ºC for 8 h and temperature increased to 100ºC for 1 h; C-- water bath at 74ºC for 2 h and temperature increased to 100ºC for 1 h;; and D-- water bath at 120ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 sec was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.
Resumo:
This study investigated the effect of simulated microwave disinfection (SMD) on the linear dimensional changes, hardness and impact strength of acrylic resins under different polymerization cycles. Metal dies with referential points were embedded in flasks with dental stone. Samples of Classico and Vipi acrylic resins were made following the manufacturers' recommendations. The assessed polymerization cycles were: A) water bath at 74 ºC for 9 h; B) water bath at 74 ºC for 8 h and temperature increased to 100 ºC for 1 h; C) water bath at 74 ºC for 2 h and temperature increased to 100 ºC for 1 h; and D) water bath at 120 ºC and pressure of 60 pounds. Linear dimensional distances in length and width were measured after SMD and water storage at 37 ºC for 7 and 30 days using an optical microscope. SMD was carried out with the samples immersed in 150 mL of water in an oven (650 W for 3 min). A load of 25 gf for 10 s was used in the hardness test. Charpy impact test was performed with 40 kpcm. Data were submitted to ANOVA and Tukey's test (5%). The Classico resin was dimensionally steady in length in the A and D cycles for all periods, while the Vipi resin was steady in the A, B and C cycles for all periods. The Classico resin was dimensionally steady in width in the C and D cycles for all periods, and the Vipi resin was steady in all cycles and periods. The hardness values for Classico resin were steady in all cycles and periods, while the Vipi resin was steady only in the C cycle for all periods. Impact strength values for Classico resin were steady in the A, C and D cycles for all periods, while Vipi resin was steady in all cycles and periods. SMD promoted different effects on the linear dimensional changes, hardness and impact strength of acrylic resins submitted to different polymerization cycles when after SMD and water storage were considered.
Resumo:
A new PLA2 (Bp-13) was purified from Bothrops pauloensis snake venom after a single chromatographic step of RP-HPLC on μ-Bondapak C-18. Amino acid analysis showed a high content of hydrophobic and basic amino acids and 14 half-cysteine residues. The N-terminal sequence showed a high degree of homology with basic Asp49 PLA2 myotoxins from other Bothrops venoms. Bp-13 showed allosteric enzymatic behavior and maximal activity at pH 8.1, 36°-45°C. Full Bp-13 PLA2 activity required Ca(2+); its PLA2 activity was inhibited by Mg(2+), Mn(2+), Sr(2+), and Cd(2+) in the presence and absence of 1 mM Ca(2+). In the mouse phrenic nerve-diaphragm (PND) preparation, the time for 50% paralysis was concentration-dependent (P < 0.05). Both the replacement of Ca(2+) by Sr(2+) and temperature lowering (24°C) inhibited the Bp-13 PLA2-induced twitch-tension blockade. Bp-13 PLA2 inhibited the contractile response to direct electrical stimulation in curarized mouse PND preparation corroborating its contracture effect. In biventer cervicis preparations, Bp-13 induced irreversible twitch-tension blockade and the KCl evoked contracture was partially, but significantly, inhibited (P > 0.05). The main effect of this new Asp49 PLA2 of Bothrops pauloensis venom is on muscle fiber sarcolemma, with avian preparation being less responsive than rodent preparation. The study enhances biochemical and pharmacological characterization of B. pauloensis venom.
Resumo:
The caffeine solubility in supercritical CO2 was studied by assessing the effects of pressure and temperature on the extraction of green coffee oil (GCO). The Peng-Robinson¹ equation of state was used to correlate the solubility of caffeine with a thermodynamic model and two mixing rules were evaluated: the classical mixing rule of van der Waals with two adjustable parameters (PR-VDW) and a density dependent one, proposed by Mohamed and Holder² with two (PR-MH, two parameters adjusted to the attractive term) and three (PR-MH3 two parameters adjusted to the attractive and one to the repulsive term) adjustable parameters. The best results were obtained with the mixing rule of Mohamed and Holder² with three parameters.
Resumo:
Kohleria eriantha (Benth.) Hanst is a plant belonging to the family Gesneriaceae, with an underground organ, which is associated with vegetative reproduction. This organ is a rhizome, whose stem bears buds covered with modified leaves that store up starch. In small sections of this rhizome, containing six buds (1.5 to 2.0cm long), only one bud sprouted. The sprouted bud could be differentiated into two morphological pattern: aerial part or rhizome. Sprouting of the rhizome pattern occurred in sections kept on substrate with low water content (1mL of water), or lacking water, whereas sprouting of the aerial part pattern occurred in sections on substrate with high water content (12mL of water). Temperature at 20ºC also stimulated sprouting of the rhizome pattern, regardless of the water volume in the substrate. Sprouting of the rhizome pattern occurred still in sections on substrate to which polyethylene glycol 6000 (PEG) solution was added at the concentrations of 161.2, 235.2 and 340.0g/L, resulting in potentials of -3, -6 and -12 MPa, respectively. Sections kept on substrate with low water content (1 ml of water) showed a reduction in the dry matter content and high osmotic concentration in comparison with those on substrate with high water content. The results obtained revealed that forming of the rhizome pattern was influenced by water content and temperature. It is suggested that sprouting of the rhizome pattern was induced by the low water potential in the sections, when kept on substrate with low water content. Moreover, it was observed that the rhizome buds of Kohleria eriantha showed a high degree of plasticity.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.