A dança no projeto "Arte, educação e cidadania" : um relato de experiencia

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Migraine Equivalents In Childhood.

Migraine equivalents are a group of periodic and paroxysmal neurologic diseases. Because headache is not a prominent symptom, the diagnosis might be challenging. The objective of the study was to evaluate the frequency and outcome of migraine equivalents. This was a retrospective study. We included benign paroxysmal torticollis of infancy, benign paroxysmal vertigo of infancy, abdominal migraine, cyclic vomiting, aura without migraine, and confusional migraine. We evaluated the frequency of events, treatment, and outcome. Out of 674 children with headache, 38 (5.6%) presented with migraine equivalents. Twenty-one were boys and the mean age was 6.1 years. Fifteen had abdominal migraine, 12 benign paroxysmal vertigo, 5 confusional migraine, 3 aura without migraine, 2 paroxysmal torticollis, and 1 cyclic vomiting. Prophylactic treatment was introduced in 23 patients; 4 lost follow-up and 19 had significant improvement. We conclude that the correct diagnosis of migraine equivalents enables an effective treatment with an excellent outcome.

Epilepsies Associated With Hippocampal Sclerosis.

Hippocampal sclerosis (HS) is considered the most frequent neuropathological finding in patients with mesial temporal lobe epilepsy (MTLE). Hippocampal specimens of pharmacoresistant MTLE patients that underwent epilepsy surgery for seizure control reveal the characteristic pattern of segmental neuronal cell loss and concomitant astrogliosis. However, classification issues of hippocampal lesion patterns have been a matter of intense debate. International consensus classification has only recently provided significant progress for comparisons of neurosurgical and clinic-pathological series between different centers. The respective four-tiered classification system of the International League Against Epilepsy subdivides HS into three types and includes a term of gliosis only, no-HS. Future studies will be necessary to investigate whether each of these subtypes of HS may be related to different etiological factors or with postoperative memory and seizure outcome. Molecular studies have provided potential deeper insights into the pathogenesis of HS and MTLE on the basis of epilepsy-surgical hippocampal specimens and corresponding animal models. These include channelopathies, activation of NMDA receptors, and other conditions related to Ca(2+) influx into neurons, the imbalance of Ca(2+)-binding proteins, acquired channelopathies that increase neuronal excitability, paraneoplastic and non-paraneoplastic inflammatory events, and epigenetic regulation promoting or facilitating hippocampal epileptogenesis. Genetic predisposition for HS is clearly suggested by the high incidence of family history in patients with HS, and by familial MTLE with HS. So far, it is clear that HS is multifactorial and there is no individual pathogenic factor either necessary or sufficient to generate this intriguing histopathological condition. The obvious variety of pathogenetic combinations underlying HS may explain the multitude of clinical presentations, different responses to clinical and surgical treatment. We believe that the stratification of neuropathological patterns can help to characterize specific clinic-pathological entities and predict the postsurgical seizure control in an improved fashion.

Bleeding Complications In Dengue Are Not Associated With Significant Changes In The Modulators Of The Endothelial Barrier.

Bleeding complications in dengue may occur irrespective of the presence of plasma leakage. We compared plasma levels of modulators of the endothelial barrier among three dengue groups: bleedings without plasma leakage, dengue hemorrhagic fever, and non-complicated dengue. The aim was to evaluate whether the presence of subtle alterations in microvascular permeability could be detected in bleeding patients. Plasma levels of VEGF-A and its soluble receptors were not associated with the occurrence of bleeding in patients without plasma leakage. These results provide additional rationale for considering bleeding as a complication independent of endothelial barrier breakdown, as proposed by the 2009 WHO classification.

Fatty Acid Synthase Inhibitors Induce Apoptosis In Non-tumorigenic Melan-a Cells Associated With Inhibition Of Mitochondrial Respiration.

The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat induce apoptosis in non-tumorigenic cells via mitochondrial dysfunction, independent of FASN inhibition.

Changes In Motor Behavior During Pregnancy In Rats: The Basis For A Possible Animal Model Of Restless Legs Syndrome.

Pregnant women have a 2-3 fold higher probability of developing restless legs syndrome (RLS - sleep-related movement disorders) than general population. This study aims to evaluate the behavior and locomotion of rats during pregnancy in order to verify if part of these animals exhibit some RLS-like features. We used 14 female 80-day-old Wistar rats that weighed between 200 and 250 g. The rats were distributed into control (CTRL) and pregnant (PN) groups. After a baseline evaluation of their behavior and locomotor activity in an open-field environment, the PN group was inducted into pregnancy, and their behavior and locomotor activity were evaluated on days 3, 10 and 19 of pregnancy and in the post-lactation period in parallel with the CTRL group. The serum iron and transferrin levels in the CTRL and PN groups were analyzed in blood collected after euthanasia by decapitation. There were no significant differences in the total ambulation, grooming events, fecal boli or urine pools between the CTRL and PN groups. However, the PN group exhibited fewer rearing events, increased grooming time and reduced immobilization time than the CTRL group (ANOVA, p<0.05). These results suggest that pregnant rats show behavioral and locomotor alterations similar to those observed in animal models of RLS, demonstrating to be a possible animal model of this sleep disorder.

Chasing Cardiac Physiology And Pathology Down The Camkii Cascade.

Calcium dynamics is central in cardiac physiology, as the key event leading to the excitation-contraction coupling (ECC) and relaxation processes. The primary function of Ca(2+) in the heart is the control of mechanical activity developed by the myofibril contractile apparatus. This key role of Ca(2+) signaling explains the subtle and critical control of important events of ECC and relaxation, such Ca(2+) influx and SR Ca(2+) release and uptake. The multifunctional Ca(2+)-calmodulin-dependent protein kinase II (CaMKII) is a signaling molecule that regulates a diverse array of proteins involved not only in ECC and relaxation, but also in cell death, transcriptional activation of hypertrophy, inflammation and arrhythmias. CaMKII activity is triggered by an increase in intracellular Ca(2+) levels. This activity can be sustained, creating molecular memory after the decline in Ca(2+) concentration, by autophosphorylation of the enzyme, as well as by oxidation, glycosylation and nitrosylation at different sites of the regulatory domain of the kinase. CaMKII activity is enhanced in several cardiac diseases, altering the signaling pathways by which CaMKII regulates the different fundamental proteins involved in functional and transcriptional cardiac processes. Dysregulation of these pathways constitutes a central mechanism of various cardiac disease phenomena, like apoptosis and necrosis during ischemia/reperfusion injury, digitalis exposure, post-acidosis and heart failure arrhythmias, or cardiac hypertrophy. Here we summarize significant aspects of the molecular physiology of CaMKII and provide a conceptual framework for understanding the role of the CaMKII cascade on Ca(2+) regulation and dysregulation in cardiac health and disease.

Key Participants Of The Tumor Microenvironment Of The Prostate: An Approach Of The Structural Dynamic Of Cellular Elements And Extracellular Matrix Components During Epithelial-stromal Transition.

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Perfil antropometrico e desempenho fisico-motor de crianças e jovens com deficiencia visual participantes do atletismo nos 1. Jogos Escolares da Confederação Brasileira de Desportos para Cegos

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia do treinamento : metodo, procedimentos pedagogicos e as multiplas competencias do tecnico nos jogos desportivos coletivos

Universidade Estadual de Campinas. Faculdade de Educação Física

Desenvolvimento de ferramentas de análise de desempenho de atletas em 3 diferentes modalidades : Handebol, Provas Combinadas e Salto com Vara

Universidade Estadual de Campinas. Faculdade de Educação Física

Respostas agudas da variabilidade da frequência cardíaca após sesão de exercício de força com restrição de fluxo sanguíneo = : Acute responses of heart rate variabiblity afer blood flow restriction resistance exercise

Universidade Estadual de Campinas . Faculdade de Educação Física