Analysis Of The Dna Fourier Transform-infrared Microspectroscopic Signature Using An All-reflecting Objective.

The Fourier transform-infrared (FT-IR) signature of dry samples of DNA and DNA-polypeptide complexes, as studied by IR microspectroscopy using a diamond attenuated total reflection (ATR) objective, has revealed important discriminatory characteristics relative to the PO2(-) vibrational stretchings. However, DNA IR marks that provide information on the sample's richness in hydrogen bonds have not been resolved in the spectral profiles obtained with this objective. Here we investigated the performance of an all reflecting objective (ARO) for analysis of the FT-IR signal of hydrogen bonds in DNA samples differing in base richness types (salmon testis vs calf thymus). The results obtained using the ARO indicate prominent band peaks at the spectral region representative of the vibration of nitrogenous base hydrogen bonds and of NH and NH2 groups. The band areas at this spectral region differ in agreement with the DNA base richness type when using the ARO. A peak assigned to adenine was more evident in the AT-rich salmon DNA using either the ARO or the ATR objective. It is concluded that, for the discrimination of DNA IR hydrogen bond vibrations associated with varying base type proportions, the use of an ARO is recommended.

Graded Meshes In Bio-thermal Problems With Transmission-line Modeling Method.

In this study, the transmission-line modeling (TLM) applied to bio-thermal problems was improved by incorporating several novel computational techniques, which include application of graded meshes which resulted in 9 times faster in computational time and uses only a fraction (16%) of the computational resources used by regular meshes in analyzing heat flow through heterogeneous media. Graded meshes, unlike regular meshes, allow heat sources to be modeled in all segments of the mesh. A new boundary condition that considers thermal properties and thus resulting in a more realistic modeling of complex problems is introduced. Also, a new way of calculating an error parameter is introduced. The calculated temperatures between nodes were compared against the results obtained from the literature and agreed within less than 1% difference. It is reasonable, therefore, to conclude that the improved TLM model described herein has great potential in heat transfer of biological systems.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Variability Modeling Of Rainfall, Deforestation, And Incidence Of American Tegumentary Leishmaniasis In Orán, Argentina, 1985-2007.

American tegumentary leishmaniasis (ATL) is a disease transmitted to humans by the female sandflies of the genus Lutzomyia. Several factors are involved in the disease transmission cycle. In this work only rainfall and deforestation were considered to assess the variability in the incidence of ATL. In order to reach this goal, monthly recorded data of the incidence of ATL in Orán, Salta, Argentina, were used, in the period 1985-2007. The square root of the relative incidence of ATL and the corresponding variance were formulated as time series, and these data were smoothed by moving averages of 12 and 24 months, respectively. The same procedure was applied to the rainfall data. Typical months, which are April, August, and December, were found and allowed us to describe the dynamical behavior of ATL outbreaks. These results were tested at 95% confidence level. We concluded that the variability of rainfall would not be enough to justify the epidemic outbreaks of ATL in the period 1997-2000, but it consistently explains the situation observed in the years 2002 and 2004. Deforestation activities occurred in this region could explain epidemic peaks observed in both years and also during the entire time of observation except in 2005-2007.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Supercritical CO2 recovery of caffeine from green coffee oil: new experimental solubility data and modeling

The caffeine solubility in supercritical CO2 was studied by assessing the effects of pressure and temperature on the extraction of green coffee oil (GCO). The Peng-Robinson¹ equation of state was used to correlate the solubility of caffeine with a thermodynamic model and two mixing rules were evaluated: the classical mixing rule of van der Waals with two adjustable parameters (PR-VDW) and a density dependent one, proposed by Mohamed and Holder² with two (PR-MH, two parameters adjusted to the attractive term) and three (PR-MH3 two parameters adjusted to the attractive and one to the repulsive term) adjustable parameters. The best results were obtained with the mixing rule of Mohamed and Holder² with three parameters.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.