12 resultados para STRAIN-SPECIFIC POLYKETIDE SYNTHASE

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat induce apoptosis in non-tumorigenic cells via mitochondrial dysfunction, independent of FASN inhibition.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The actinobacterium Streptomyces wadayamensis A23 is an endophyte of Citrus reticulata that produces the antimycin and mannopeptimycin antibiotics, among others. The strain has the capability to inhibit Xylella fastidiosa growth. The draft genome of S. wadayamensis A23 has ~7.0 Mb and 6,006 protein-coding sequences, with a 73.5% G+C content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A proper cast is essential for a successful rehabilitation with implant prostheses, in order to produce better structures and induce less strain on the implants. The aim of this study was to evaluate the precision of four different mold filling techniques and verify an accurate methodology to evaluate these techniques. A total of 40 casts were obtained from a metallic matrix simulating three unit implant-retained prostheses. The molds were filled using four different techniques in four groups (n = 10): Group 1 - Single-portion filling technique; Group 2 - Two-step filling technique; Group 3 - Latex cylinder technique; Group 4 - Joining the implant analogs previously to the mold filling. A titanium framework was obtained and used as a reference to evaluate the marginal misfit and tension forces in each cast. Vertical misfit was measured with an optical microscope with an increase of 120 times following the single-screw test protocol. Strain was quantified using strain gauges. Data were analyzed using one-way ANOVA (Tukey's test) (α =0.05). The correlation between strain and vertical misfit was evaluated by Pearson test. The misfit values did not present statistical difference (P = 0.979), while the strain results showed statistical difference between Groups 3 and 4 (P = 0.027). The splinting technique was considered to be as efficient as the conventional technique. The strain gauge methodology was accurate for strain measurements and cast distortion evaluation. There was no correlation between strain and marginal misfit.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física