Design, Synthesis And Biological Evaluation Of Hybrid Bioisoster Derivatives Of N-acylhydrazone And Furoxan Groups With Potential And Selective Anti-trypanosoma Cruzi Activity.

Hybrid bioisoster derivatives from N-acylhydrazones and furoxan groups were designed with the objective of obtaining at least a dual mechanism of action: cruzain inhibition and nitric oxide (NO) releasing activity. Fifteen designed compounds were synthesized varying the substitution in N-acylhydrazone and in furoxan group as well. They had its anti-Trypanosoma cruzi activity in amastigotes forms, NO releasing potential and inhibitory cruzain activity evaluated. The two most active compounds (6, 14) both in the parasite amastigotes and in the enzyme contain the nitro group in para position of the aromatic ring. The permeability screening in Caco-2 cell and cytotoxicity assay in human cells were performed for those most active compounds and both showed to be less cytotoxic than the reference drug, benznidazole. Compound 6 was the most promising, since besides activity it showed good permeability and selectivity index, higher than the reference drug. Thereby the compound 6 was considered as a possible candidate for additional studies.

Improved Selective Cholesterol Adsorption By Molecularly Imprinted Poly(methacrylic Acid)/silica (pmaa-sio₂) Hybrid Material Synthesized With Different Molar Ratios.

The present paper describes the synthesis of molecularly imprinted polymer - poly(methacrylic acid)/silica and reports its performance feasibility with desired adsorption capacity and selectivity for cholesterol extraction. Two imprinted hybrid materials were synthesized at different methacrylic acid (MAA)/tetraethoxysilane (TEOS) molar ratios (6:1 and 1:5) and characterized by FT-IR, TGA, SEM and textural data. Cholesterol adsorption on hybrid materials took place preferably in apolar solvent medium, especially in chloroform. From the kinetic data, the equilibrium time was reached quickly, being 12 and 20 min for the polymers synthesized at MAA/TEOS molar ratio of 6:1 and 1:5, respectively. The pseudo-second-order model provided the best fit for cholesterol adsorption on polymers, confirming the chemical nature of the adsorption process, while the dual-site Langmuir-Freundlich equation presented the best fit to the experimental data, suggesting the existence of two kinds of adsorption sites on both polymers. The maximum adsorption capacities obtained for the polymers synthesized at MAA/TEOS molar ratios of 6:1 and 1:5 were found to be 214.8 and 166.4 mg g(-1), respectively. The results from isotherm data also indicated higher adsorption capacity for both imprinted polymers regarding to corresponding non-imprinted polymers. Nevertheless, taking into account the retention parameters and selectivity of cholesterol in the presence of structurally analogue compounds (5-α-cholestane and 7-dehydrocholesterol), it was observed that the polymer synthesized at the MAA/TEOS molar ratio of 6:1 was much more selective for cholesterol than the one prepared at the ratio of 1:5, thus suggesting that selective binding sites ascribed to the carboxyl group from MAA play a central role in the imprinting effect created on MIP.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Recentes avanços e novas perspectivas dos eletrodos íon-seletivos

This paper describes the recent progress in the development of polymeric membranes for ion-selective electrodes. The importance of knowing the mechanism of potential development in membranes for ion-selective electrodes to reach lower detection limits and improve selectivity are discussed. Recent advances and future trends of research on ion-selective electrodes are also reported.

O estado da arte da cromatografia associada à espectrometria de massas acoplada à espectrometria de massas na análise de compostos tóxicos em alimentos

Chromatography combined with several different detection systems is one of the more used and better performing analytical tools. Chromatography with tandem mass spectrometric detection gives highly selective and sensitive analyses and permits obtaining structural information about the analites and about their molar masses. Due to these characteristics, this analytical technique is very efficient when used to detect substances at trace levels in complex matrices. In this paper we review instrumental and technical aspects of chromatography-tandem mass spectrometry and the state of the art of the technique as it is applied to analysis of toxic substances in food.

Validação e estimativa da incerteza de método para análise de licopeno e β-caroteno em polpa de tomate por cromatografia líquida de alta eficiência

A method to quantify lycopene and β-carotene in freeze dried tomato pulp by high performance liquid chromatography (HLPC) was validated according to the criteria of selectivity, sensitivity, precision and accuracy, and uncertainty estimation of measurement was determined with data obtained in the validation. The validated method presented is selective in terms of analysis, and it had a good precision and accuracy. Detection limit for lycopene and β-carotene was 4.2 and 0.23 mg 100 g-1, respectively. The estimation of expanded uncertainty (K = 2) for lycopene was 104 ± 21 mg 100 g-1 and for β-carotene was 6.4 ± 1.5 mg 100 g-1.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.