High-resolution Transcript Profiling Of The Atypical Biotrophic Interaction Between Theobroma Cacao And The Fungal Pathogen Moniliophthora Perniciosa.

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Many Thanks To Our Eternal Editor Of The Revista Brasileira De Hematologia E Hemoterapia, Professor Milton Artur Ruiz.

37

Phylogenetics, Ancestral State Reconstruction, And A New Infrafamilial Classification Of The Pantropical Ochnaceae (medusagynaceae, Ochnaceae S.str., Quiinaceae) Based On Five Dna Regions.

Ochnaceae s.str. (Malpighiales) are a pantropical family of about 500 species and 27 genera of almost exclusively woody plants. Infrafamilial classification and relationships have been controversial partially due to the lack of a robust phylogenetic framework. Including all genera except Indosinia and Perissocarpa and DNA sequence data for five DNA regions (ITS, matK, ndhF, rbcL, trnL-F), we provide for the first time a nearly complete molecular phylogenetic analysis of Ochnaceae s.l. resolving most of the phylogenetic backbone of the family. Based on this, we present a new classification of Ochnaceae s.l., with Medusagynoideae and Quiinoideae included as subfamilies and the former subfamilies Ochnoideae and Sauvagesioideae recognized at the rank of tribe. Our data support a monophyletic Ochneae, but Sauvagesieae in the traditional circumscription is paraphyletic because Testulea emerges as sister to the rest of Ochnoideae, and the next clade shows Luxemburgia+Philacra as sister group to the remaining Ochnoideae. To avoid paraphyly, we classify Luxemburgieae and Testuleeae as new tribes. The African genus Lophira, which has switched between subfamilies (here tribes) in past classifications, emerges as sister to all other Ochneae. Thus, endosperm-free seeds and ovules with partly to completely united integuments (resulting in an apparently single integument) are characters that unite all members of that tribe. The relationships within its largest clade, Ochnineae (former Ochneae), are poorly resolved, but former Ochninae (Brackenridgea, Ochna) are polyphyletic. Within Sauvagesieae, the genus Sauvagesia in its broad circumscription is polyphyletic as Sauvagesia serrata is sister to a clade of Adenarake, Sauvagesia spp., and three other genera. Within Quiinoideae, in contrast to former phylogenetic hypotheses, Lacunaria and Touroulia form a clade that is sister to Quiina. Bayesian ancestral state reconstructions showed that zygomorphic flowers with adaptations to buzz-pollination (poricidal anthers), a syncarpous gynoecium (a near-apocarpous gynoecium evolved independently in Quiinoideae and Ochninae), numerous ovules, septicidal capsules, and winged seeds with endosperm are the ancestral condition in Ochnoideae. Although in some lineages poricidal anthers were lost secondarily, the evolution of poricidal superstructures secured the maintenance of buzz-pollination in some of these genera, indicating a strong selective pressure on keeping that specialized pollination system.

Phylogenetic Analysis Of The Microbial Community In Hypersaline Petroleum Produced Water From The Campos Basin.

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

The Influence Of The Environment On The Development Of Thyroid Tumors: A New Appraisal.

Most epidemiological studies concerning differentiated thyroid cancers (DTC) indicate an increasing incidence over the last two decades. This increase might be partially explained by the better access to health services worldwide, but clinicopathological analyses do not fully support this hypothesis, indicating that there are carcinogenetic factors behind this noticeable increasing incidence. Although we have undoubtedly understood the biology and molecular pathways underlying thyroid carcinogenesis in a better way, we have made very little progresses in identifying a risk profile for DTC, and our knowledge of risk factors is very similar to what we knew 30-40 years ago. In addition to ionizing radiation exposure, the most documented and established risk factor for DTC, we also investigated the role of other factors, including eating habits, tobacco smoking, living in a volcanic area, xenobiotics, and viruses, which could be involved in thyroid carcinogenesis, thus, contributing to the increase in DTC incidence rates observed.

The Effect Of Celastrol, A Triterpene With Antitumorigenic Activity, On Conformational And Functional Aspects Of The Human 90kda Heat Shock Protein Hsp90α, A Chaperone Implicated In The Stabilization Of The Tumor Phenotype.

Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.

Feasibility And Reproducibility Of Diffusion-weighted Magnetic Resonance Imaging Of The Fetal Brain In Twin-twin Transfusion Syndrome.

The aim of this study is to test the feasibility and reproducibility of diffusion-weighted magnetic resonance imaging (DW-MRI) evaluations of the fetal brains in cases of twin-twin transfusion syndrome (TTTS). From May 2011 to June 2012, 24 patients with severe TTTS underwent MRI scans for evaluation of the fetal brains. Datasets were analyzed offline on axial DW images and apparent diffusion coefficient (ADC) maps by two radiologists. The subjective evaluation was described as the absence or presence of water diffusion restriction. The objective evaluation was performed by the placement of 20-mm(2) circular regions of interest on the DW image and ADC maps. Subjective interobserver agreement was assessed by the kappa correlation coefficient. Objective intraobserver and interobserver agreements were assessed by proportionate Bland-Altman tests. Seventy-four DW-MRI scans were performed. Sixty of them (81.1%) were considered to be of good quality. Agreement between the radiologists was 100% for the absence or presence of diffusion restriction of water. For both intraobserver and interobserver agreement of ADC measurements, proportionate Bland-Altman tests showed average percentage differences of less than 1.5% and 95% CI of less than 18% for all sites evaluated. Our data demonstrate that DW-MRI evaluation of the fetal brain in TTTS is feasible and reproducible.

On Advertisement Call Of The Poison Frog Ameerega Berohoka (dendrobatidae, Anura) From The Brazilian Cerrado.

The poison frog genus Ameerega (Dendrobatidae) currently contains 32 species. They are distributed from central Brazil into western Amazonia to the lower Andean versant. In addition, three trans-Andean species have been allocated to Ameerega (Andrade et al. 2013; Frost 2014). Ameerega berohoka (Vaz-Silva & Maciel 2011) was described based on specimens from central Brazil (type-locality: Arenópolis, GO) and it is assumed to occur in parts of western and southwestern state of Goiás (Frost 2014). More recently, Andrade et al. (2013) extended its distribution to the state of Mato Grosso. Here we re-describe the advertisement call of A. berohoka, providing additional information regarding its temporal structure and spectral traits. Our observations also consist of a new distribution record for this species to the state of Mato Grosso.

Beam Energy Dependence Of Moments Of The Net-charge Multiplicity Distributions In Au+au Collisions At Rhic.

We report the first measurements of the moments--mean (M), variance (σ(2)), skewness (S), and kurtosis (κ)--of the net-charge multiplicity distributions at midrapidity in Au+Au collisions at seven energies, ranging from sqrt[sNN]=7.7 to 200 GeV, as a part of the Beam Energy Scan program at RHIC. The moments are related to the thermodynamic susceptibilities of net charge, and are sensitive to the location of the QCD critical point. We compare the products of the moments, σ(2)/M, Sσ, and κσ(2), with the expectations from Poisson and negative binomial distributions (NBDs). The Sσ values deviate from the Poisson baseline and are close to the NBD baseline, while the κσ(2) values tend to lie between the two. Within the present uncertainties, our data do not show nonmonotonic behavior as a function of collision energy. These measurements provide a valuable tool to extract the freeze-out parameters in heavy-ion collisions by comparing with theoretical models.

Understanding Red Blood Cell Parameters In The Context Of The Frailty Phenotype: Interpretations Of The Fibra (frailty In Brazilian Seniors) Study.

Frailty and anemia in the elderly appear to share a common pathophysiology associated with chronic inflammatory processes. This study uses an analytical, cross-sectional, population-based methodology to investigate the probable relationships between frailty, red blood cell parameters and inflammatory markers in 255 community-dwelling elders aged 65 years or older. The frailty phenotype was assessed by non-intentional weight loss, fatigue, low grip strength, low energy expenditure and reduced gait speed. Blood sample analyses were performed to determine hemoglobin level, hematocrit and reticulocyte count, as well as the inflammatory variables IL-6, IL-1ra and hsCRP. In the first multivariate analysis (model I), considering only the erythroid parameters, Hb concentration was a significant variable for both general frailty status and weight loss: a 1.0g/dL drop in serum Hb concentration represented a 2.02-fold increase (CI 1.12-3.63) in an individual's chance of being frail. In the second analysis (model II), which also included inflammatory cytokine levels, hsCRP was independently selected as a significant variable. Each additional year of age represented a 1.21-fold increase in the chance of being frail, and each 1-unit increase in serum hsCRP represented a 3.64-fold increase in the chance of having the frailty phenotype. In model II reticulocyte counts were associated with weight loss and reduced metabolic expenditure criteria. Our findings suggest that reduced Hb concentration, reduced RetAbs count and elevated serum hsCRP levels should be considered components of frailty, which in turn is correlated with sarcopenia, as evidenced by weight loss.

The Prevalence Of The Metabolically Healthy Obese Phenotype In An Aging Population And Its Association With Subclinical Cardiovascular Disease: The Brazilian Study On Healthy Aging.

Current literature has elucidated a new phenotype, metabolically healthy obese (MHO), with risks of cardiovascular disease similar to that of normal weight individuals. Few studies have examined the MHO phenotype in an aging population, especially in association with subclinical CVD. This cross sectional study population consisted of 208 octogenarians and older. Anthropometrics, biochemical, and radiological parameters were measured to assess obesity, metabolic health (assessed by the National Cholesterol Education Program -Adult Treatment Panel (NCEP-ATP III) criteria), and subclinical measures of CVD. The prevalence of MHO was 13.5% (N = 28). No significant association with MHO was noted for age, coronary artery calcium score, cIMT, or hs-CRP > 3 mg/dl (p = NS). Our results suggest that the MHO phenotype exists in the elderly; however, subclinical CVD measures were not different in sub-group analysis suggesting traditional metabolic risk factor algorithms may not be accurate in the very elderly.

Sci1 Is A Component Of The Auxin-dependent Control Of Cell Proliferation In Arabidopsis Upper Pistil.

To characterize the recently described SCI1 (stigma/style cell cycle inhibitor 1) gene relationship with the auxin pathway, we have taken the advantage of the Arabidopsis model system and its available tools. At first, we have analyzed the At1g79200 T-DNA insertion mutants and constructed various transgenic plants. The loss- and gain-of-function plants displayed cell number alterations in upper pistils that were controlled by the amino-terminal domain of the protein. These data also confirmed that this locus holds the functional homolog (AtSCI1) of the Nicotiana tabacum SCI1 gene. Then, we have provided some evidences the auxin synthesis/signaling pathways are required for downstream proper AtSCI1 control of cell number: (a) its expression is downregulated in yuc2yuc6 and npy1 auxin-deficient mutants, (b) triple (yuc2yuc6sci1) and double (npy1sci1) mutants mimicked the auxin-deficient phenotypes, with no synergistic interactions, and (c) the increased upper pistil phenotype in these last mutants, which is a consequence of an increased cell number, was able to be complemented by AtSCI1 overexpression. Taken together, our data strongly suggests SCI1 as a component of the auxin signaling transduction pathway to control cell proliferation/differentiation in stigma/style, representing a molecular effector of this hormone on pistil development.

Chronicity Factors Of Temporomandibular Disorders: A Critical Review Of The Literature.

Facial pain often persists long after any identifiable organic pathology has healed. Moreover, in a subgroup of patients with temporomandibular disorder (TMD), no treatment is effective. Knowledge of factors associated with persistent pain in TMD could help identify personalized treatment approaches. Therefore, we conducted a critical review of the literature for the period from January 2000 to December 2013 to identify factors related to TMD development and persistence. The literature findings showed that chronic TMD is marked by psychological distress (somatization and depression, affective distress, fear of pain, fear of movement, and catastrophizing) and characteristics of pain amplification (hyperalgesia and allodynia). Furthermore, these factors seem to interact in TMD development. In addition, our review demonstrates that upregulation of the serotonergic pathway, sleep problems, and gene polymorphisms influence the chronicity of TMD. We conclude that psychological distress and pain amplification contribute to chronic TMD development, and that interactions among these factors complicate pain management. These findings emphasize the importance of multidisciplinary assistance in TMD treatment.

Kinase Inhibitor Profile For Human Nek1, Nek6, And Nek7 And Analysis Of The Structural Basis For Inhibitor Specificity.

Human Neks are a conserved protein kinase family related to cell cycle progression and cell division and are considered potential drug targets for the treatment of cancer and other pathologies. We screened the activation loop mutant kinases hNek1 and hNek2, wild-type hNek7, and five hNek6 variants in different activation/phosphorylation statesand compared them against 85 compounds using thermal shift denaturation. We identified three compounds with significant Tm shifts: JNK Inhibitor II for hNek1(Δ262-1258)-(T162A), Isogranulatimide for hNek6(S206A), andGSK-3 Inhibitor XIII for hNek7wt. Each one of these compounds was also validated by reducing the kinases activity by at least 25%. The binding sites for these compounds were identified by in silico docking at the ATP-binding site of the respective hNeks. Potential inhibitors were first screened by thermal shift assays, had their efficiency tested by a kinase assay, and were finally analyzed by molecular docking. Our findings corroborate the idea of ATP-competitive inhibition for hNek1 and hNek6 and suggest a novel non-competitive inhibition for hNek7 in regard to GSK-3 Inhibitor XIII. Our results demonstrate that our approach is useful for finding promising general and specific hNekscandidate inhibitors, which may also function as scaffolds to design more potent and selective inhibitors.