Culturable Bacterial Diversity From A Feed Water Of A Reverse Osmosis System, Evaluation Of Biofilm Formation And Biocontrol Using Phages.

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Obesity Versus Osteoarthritis: Beyond The Mechanical Overload.

Obesity is currently considered a major public health problem in the world, already reaching epidemic characteristics, according to the World Health Organization. Excess weight is the major risk factor associated with various diseases, such as type 2 diabetes mellitus, hypertension, dyslipidemia and osteometabolic diseases, including osteoporosis and osteoarthritis. Osteoarthritis is the most prevalent rheumatic disease and the leading cause of physical disability and reduced quality of life of the population over 65 years. It mainly involves the joints that bear weight - knees and hips. However, along with the cases of obesity, its prevalence is increasing, and even in other joints, such as hands. Thus, it is assumed that the influence of obesity on the development of OA is beyond mechanical overload. The purpose of this review was to correlate the possible mechanisms underlying the genesis and development of these two diseases. Increased fat mass is directly proportional to excessive consumption of saturated fatty acids, responsible for systemic low-grade inflammation condition and insulin and leptin resistance. At high levels, leptin assumes inflammatory characteristics and acts in the articular cartilage, triggering the inflammatory process and changing homeostasis this tissue with consequent degeneration. We conclude that obesity is a risk factor for osteoarthritis and that physical activity and changes in diet composition can reverse the inflammatory and leptin resistance, reducing progression or preventing the onset of osteoarthritis.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

[in Process Citation].

20

Didanosine-loaded Chitosan Microspheres Optimized By Surface-response Methodology: A Modified Maximum Likelihood Classification" Approach Formulation For Reverse Transcriptase Inhibitors."

Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física

Hegemonia e contra-hegemonia na construção de políticas de esporte e lazer : a experiência do Consórcio Brasília = Hegemony and counter-hegemony in the process of sport and leisure policy-making : the experience of the Consortium Brasilia

Universidade Estadual de Campinas . Faculdade de Educação Física