Ikkε Is Key To Induction Of Insulin Resistance In The Hypothalamus, And Its Inhibition Reverses Obesity.

IKK epsilon (IKKε) is induced by the activation of nuclear factor-κB (NF-κB). Whole-body IKKε knockout mice on a high-fat diet (HFD) were protected from insulin resistance and showed altered energy balance. We demonstrate that IKKε is expressed in neurons and is upregulated in the hypothalamus of obese mice, contributing to insulin and leptin resistance. Blocking IKKε in the hypothalamus of obese mice with CAYMAN10576 or small interfering RNA decreased NF-κB activation in this tissue, relieving the inflammatory environment. Inhibition of IKKε activity, but not TBK1, reduced IRS-1(Ser307) phosphorylation and insulin and leptin resistance by an improvement of the IR/IRS-1/Akt and JAK2/STAT3 pathways in the hypothalamus. These improvements were independent of body weight and food intake. Increased insulin and leptin action/signaling in the hypothalamus may contribute to a decrease in adiposity and hypophagia and an enhancement of energy expenditure accompanied by lower NPY and increased POMC mRNA levels. Improvement of hypothalamic insulin action decreases fasting glycemia, glycemia after pyruvate injection, and PEPCK protein expression in the liver of HFD-fed and db/db mice, suggesting a reduction in hepatic glucose production. We suggest that IKKε may be a key inflammatory mediator in the hypothalamus of obese mice, and its hypothalamic inhibition improves energy and glucose metabolism.

Mechanisms Of Insulin Resistance In The Amygdala: Influences On Food Intake.

Obesity is increasing worldwide and is triggered, at least in part, by enhanced caloric intake. Food intake is regulated by a complex mechanism involving the hypothalamus and hindbrain circuitries. However, evidences have showing that reward systems are also important in regulating feeding behavior. In this context, amygdala is considered a key extra-hypothalamic area regulating feeding behavior in human beings and rodents. This review focuses on the regulation of food intake by amygdala and the mechanisms of insulin resistance in this brain area. Similar to the hypothalamus the anorexigenic effect of insulin is mediated via PI3K (phosphoinositide 3-kinase)/Akt (protein kinase B) pathway in the amygdala. Insulin decreases NPY (neuropeptide Y) and increases oxytocin mRNA levels in the amygdala. High fat diet and saturated fatty acids induce inflammation, ER (endoplasmic reticulum) stress and the activation of serine kinases such as PKCθ (protein kinase C theta), JNK (c-Jun N-terminal kinase) and IKKβ (inhibitor of nuclear factor kappa-B kinase beta) in the amygdala, which have an important role in insulin resistance in this brain region. Overexpressed PKCθ in the CeA (central nucleus of amygdala) of rats increases weight gain, food intake, insulin resistance and hepatic triglycerides content. The inhibition of ER stress ameliorates insulin action/signaling, increases oxytocin and decreases NPY gene expression in the amygdala of high fat feeding rodents. Those data suggest that PKCθ and ER stress are main mechanisms of insulin resistance in the amygdala of obese rats and play an important role regulating feeding behavior.

Development Plates For Stable Internal Fixation: Study Of Mechanical Resistance In Simulated Fractures Of The Mandibular Condyle.

To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Testosterone Therapy Differently Regulates The Anti- And Pro-inflammatory Cytokines In The Plasma And Prostate Of Rats Submitted To Chronic Ethanol Consumption (uchb).

Ethanol consumption damages the prostate, and testosterone is known by anti-inflammatory role. The cytokines were investigated in the plasma and ventral prostate of UChB rats submitted or not to testosterone therapy by ELISA and Western blot, respectively. Additionally, inflammatory foci and mast cells were identified in the ventral prostate slides stained by hematoxylin and eosin and toluidine blue, respectively. Inflammatory foci were found in the ethanol-treated animals and absent after testosterone therapy. Plasma levels of IL-6 and IL-10 were not changed while TNFα and TFG-β1 were increased in the animals submitted testosterone therapy. Regarding to ventral prostate, IL-6 did not alter, while IL-10, TNFα, and TFG-β1 were increased after testosterone therapy. Ethanol increases NFR2 in addition to high number of intact and degranulated mast cell which were reduced after testosterone therapy. So, ethanol and testosterone differentially modulates the cytokines in the plasma and prostate.

Diet Carotenoid Lutein Modulates The Expression Of Genes Related To Oxygen Transporters And Decreases Dna Damage And Oxidative Stress In Mice.

Lutein (LT) is a carotenoid obtained by diet and despite its antioxidant activity had been biochemically reported, few studies are available concerning its influence on the expression of antioxidant genes. The expression of 84 genes implicated in antioxidant defense was quantified using quantitative reverse transcription polymerase chain reaction array. DNA damage was measured by comet assay and glutathione (GSH) and thiobarbituric acid reactive substances (TBARS) were quantified as biochemical parameters of oxidative stress in mouse kidney and liver. cDDP treatment reduced concentration of GSH and increased TBARS, parameters that were ameliorated in treatment associated with LT. cDDP altered the expression of 32 genes, increasing the expression of GPx2, APC, Nqo1 and CCs. LT changed the expression of 37 genes with an induction of 13 mainly oxygen transporters. In treatments associating cDDP and LT, 30 genes had their expression changed with a increase of the same genes of the cDDP treatment alone. These results suggest that LT might act scavenging reactive species and also inducing the expression of genes related to a better antioxidant response, highlighting the improvement of oxygen transport. This improved redox state of the cell through LT treatment could be related to the antigenotoxic and antioxidant effects observed.

Perception Of Oral And Maxillofacial Surgeons, Orthodontists And Laypersons In Relation To The Harmony Of The Smile.

Harmony is one of the main objectives in surgical and orthodontic treatment and this harmony must be present in the smile, as well as in the face. The aim of the present study was to assess the perceptions of professionals and laypersons in relation to the harmony of the smile of patients with or without vertical maxillary alterations. Sixty observers (oral and maxillofacial surgeons, orthodontists and laypersons) reported the degree of harmony of six smiles using an objective questionnaire and the participants indicated if there was a need for corrective surgery or not. The classification of observers was recorded on a Likert scale from 1 to 5. Mixed regression was used to determine differences between the three groups. Statistically significant differences were found only for the harmony of the smile between the oral and maxillofacial surgeons and laypersons, with laypersons being more critical when assessing the smile. There was no statistical difference between the other groups for the harmony of the smile or the indication of corrective surgery. The patterns of greater or lesser harmony determined by observers during the smile were similar to those found in the literature as the ideal standard in relation to vertical maxillary positioning. Laypersons had a tendency to be more critical in relation to facial harmony than surgeons, although no statistical differences were found in the other groups in relation to the harmony of the smile or indication for the corrective surgery. In addition, the patterns of greater or lesser harmony of the smile determined by the participants were similar to those found in the literature as the ideal standard in relation to vertical maxillary positioning. Overall, the present study demonstrates that adequate interaction between surgeons, orthodontists and laypersons is essential in order to achieve facial harmony with orthodontic and/or surgical treatment. Opinion of specialists and laypersons about the smile in relation to the vertical positioning of the maxilla.

Emergent Antiferromagnetism Out Of The Hidden-order" State In Uru2si2: High Magnetic Field Nuclear Magnetic Resonance To 40 T."

Very high field (29)Si-NMR measurements using a fully (29)Si-enriched URu(2)Si(2) single crystal were carried out in order to microscopically investigate the hidden order (HO) state and adjacent magnetic phases in the high field limit. At the lowest measured temperature of 0.4 K, a clear anomaly reflecting a Fermi surface instability near 22 T inside the HO state is detected by the (29)Si shift, (29)K(c). Moreover, a strong enhancement of (29)K(c) develops near a critical field H(c) ≃ 35.6 T, and the ^{29}Si-NMR signal disappears suddenly at H(c), indicating the total suppression of the HO state. Nevertheless, a weak and shifted (29)Si-NMR signal reappears for fields higher than H(c) at 4.2 K, providing evidence for a magnetic structure within the magnetic phase caused by the Ising-type anisotropy of the uranium ordered moments.

Imported Malaria In A Non-endemic Area: The Experience Of The University Of Campinas Hospital In The Brazilian Southeast.

Although malaria in Brazil almost exclusively occurs within the boundaries of the Amazon Region, some concerns are raised regarding imported malaria to non-endemic areas of the country, notably increased incidence of complications due to delayed diagnoses. However, although imported malaria in Brazil represents a major health problem, only a few studies have addressed this subject. A retrospective case series is presented in which 263 medical charts were analysed to investigate the clinical and epidemiological characterization of malaria cases that were diagnosed and treated at Hospital & Clinics, State University of Campinas between 1998 and 2011. Amongst all medical charts analysed, 224 patients had a parasitological confirmed diagnosis of malaria. Plasmodium vivax and Plasmodium falciparum were responsible for 67% and 30% of the infections, respectively. The majority of patients were male (83%) of a productive age (median, 37 years old). Importantly, severe complications did not differ significantly between P. vivax (14 cases, 9%) and P. falciparum (7 cases, 10%) infections. Severe malaria cases were frequent among imported cases in Brazil outside of the Amazon area. The findings reinforce the idea that P. vivax infections in Brazil are not benign, regardless the endemicity of the area studied. Moreover, as the hospital is located in a privileged site, it could be used for future studies of malaria relapses and primaquine resistance mechanisms. Finally, based on the volume of cases treated and the secondary complications, referral malaria services are needed in the non-endemic areas of Brazil for a rapid and efficient and treatment.

Petroleomics By Electrospray Ionization Ft-icr Mass Spectrometry Coupled To Partial Least Squares With Variable Selection Methods: Prediction Of The Total Acid Number Of Crude Oils.

Negative-ion mode electrospray ionization, ESI(-), with Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) was coupled to a Partial Least Squares (PLS) regression and variable selection methods to estimate the total acid number (TAN) of Brazilian crude oil samples. Generally, ESI(-)-FT-ICR mass spectra present a power of resolution of ca. 500,000 and a mass accuracy less than 1 ppm, producing a data matrix containing over 5700 variables per sample. These variables correspond to heteroatom-containing species detected as deprotonated molecules, [M - H](-) ions, which are identified primarily as naphthenic acids, phenols and carbazole analog species. The TAN values for all samples ranged from 0.06 to 3.61 mg of KOH g(-1). To facilitate the spectral interpretation, three methods of variable selection were studied: variable importance in the projection (VIP), interval partial least squares (iPLS) and elimination of uninformative variables (UVE). The UVE method seems to be more appropriate for selecting important variables, reducing the dimension of the variables to 183 and producing a root mean square error of prediction of 0.32 mg of KOH g(-1). By reducing the size of the data, it was possible to relate the selected variables with their corresponding molecular formulas, thus identifying the main chemical species responsible for the TAN values.

Histologic Correlation Of Expression Of Ki-67 In Squamous Cell Carcinoma Of The Glottis According To The Degree Of Cell Differentiation.

Squamous cell carcinoma is the most common neoplasm of the larynx and glottis, and its prognosis depends on the size of the lesion, level of local invasion, cervical lymphatic spread, and presence of distant metastases. Ki-67 (MKI67) is a protein present in the core, whose function is related to cell proliferation. To evaluate the expression of marker Ki-67 in squamous cell carcinoma of the larynx and glottis and its correlation to pathological findings. Experimental study with immunohistochemistry analysis of Ki-67, calculating the percentage of the cell proliferation index in glottic squamous cell carcinomas. Sixteen cases were analyzed, with six well-differentiated and 10 poorly/moderately differentiated tumors. There was a correlation between cell proliferation index and degree of cell differentiation, with higher proliferation in poorly/moderately differentiated tumors. The cell proliferation index, as measured by Ki-67, may be useful in the characterization of histological degree in glottic squamous cell tumors.

[the Perception Of Behavior Related To Mindfulness And The Brazilian Version Of The Freiburg Mindfulness Inventory].

Mindfulness is a practice and a form of consciousness which has been the basis for innovative interventions in care and health promotion. This study presents mindfulness, describes and discusses the process of cultural adaptation of The Freiburg Mindfulness Inventory (FMI) to Brazilian Portuguese. From the original version of this pioneering instrument for assessing mindfulness two translations and two back-translations were made. These were evaluated by a committee of 14 experts (Buddhists, linguists, health professionals), who helped to create two versions for the first pre-test, based on which suggestions were made by a sample of 41 people of the population through interviews. Considering the difficulties in understanding the concepts that are unfamiliar to the Brazilian culture, a new version was prepared with additional explanations, which underwent a further evaluation of the experts and a second pre-test with 72 people. This process aimed at addressing the limitations and challenges of evaluating mindfulness in a country of western culture through a self-report instrument based on Buddhist psychology. With appropriate levels of clarity and equivalence with the original instrument, the Freiburg Mindfulness Inventory adapted for Brazil is presented.

Cervical Injuries Scored According To The Subaxial Injury Classification System: An Analysis Of The Literature.

The Subaxial Injury Classification (SLIC) system and severity score has been developed to help surgeons in the decision-making process of treatment of subaxial cervical spine injuries. A detailed description of all potential scored injures of the SLIC is lacking. We performed a systematic review in the PubMed database from 2007 to 2014 to describe the relationship between the scored injuries in the SLIC and their eventual treatment according to the system score. Patients with an SLIC of 1-3 points (conservative treatment) are neurologically intact with the spinous process, laminar or small facet fractures. Patients with compression and burst fractures who are neurologically intact are also treated nonsurgically. Patients with an SLIC of 4 points may have an incomplete spinal cord injury such as a central cord syndrome, compression injuries with incomplete neurologic deficits and burst fractures with complete neurologic deficits. SLIC of 5-10 points includes distraction and rotational injuries, traumatic disc herniation in the setting of a neurological deficit and burst fractures with an incomplete neurologic deficit. The SLIC injury severity score can help surgeons guide fracture treatment. Knowledge of the potential scored injures and their relationships with the SLIC are of paramount importance for spine surgeons who treated subaxial cervical spine injuries.

Analysis Of The Contribution Of Immunologically-detectable Her2, Steroid Receptors And Of The Triple-negative" Tumor Status To Disease-free And Overall Survival Of Women With Epithelial Ovarian Cancer."

We assessed associations between steroid receptors including: estrogen-alpha, estrogen-beta, androgen receptor, progesterone receptor, the HER2 status and triple-negative epithelial ovarian cancer (ERα-/PR-/HER2-; TNEOC) status and survival in women with epithelial ovarian cancer. The study included 152 women with primary epithelial ovarian cancer. The status of steroid receptor and HER2 was determined by immunohistochemistry. Disease-free and overall survival were calculated and compared with steroid receptor and HER2 status as well as clinicopathological features using the Cox Proportional Hazards model. A mean follow-up period of 43.6 months (interquartile range=41.4 months) was achieved where 44% of patients had serous tumor, followed by mucinous (23%), endometrioid (9%), mixed (9%), undifferentiated (8.5%) and clear cell tumors (5.3%). ER-alpha staining was associated with grade II-III tumors. Progesterone receptor staining was positively associated with a Body Mass Index≥25. Androgen receptor positivity was higher in serous tumors. In stand-alone analysis of receptor contribution to survival, estrogen-alpha positivity was associated with greater disease-free survival. However, there was no significant association between steroid receptor expression, HER2 status, or TNEOC status, and overall survival. Although estrogen-alpha, androgen receptor, progesterone receptor and the HER2 status were associated with key clinical features of the women and pathological characteristics of the tumors, these associations were not implicated in survival. Interestingly, women with TNEOC seem to fare the same way as their counterparts with non-TNEOC.