12 resultados para Rapid toxin detection

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The presynaptic action of Bothriopsis bilineata smaragdina (forest viper) venom and Bbil-TX, an Asp49 PLA2 from this venom, was examined in detail in mouse phrenic nerve-muscle (PND) preparations in vitro and in a neuroblastoma cell line (SK-N-SH) in order to gain a better insight into the mechanism of action of the venom and associated Asp49 PLA2. In low Ca(2+) solution, venom (3μg/ml) caused a quadriphasic response in PND twitch height whilst at 10μg/ml the venom additionally induced an abrupt and marked initial contracture followed by neuromuscular facilitation, rhythmic oscillations of nerve-evoked twitches, alterations in baseline and progressive blockade. The venom slowed the relaxation phase of muscle twitches. In low Ca(2+), Bbil-TX [210nM (3μg/ml)] caused a progressive increase in PND twitch amplitude but no change in the decay time constant. Venom (10μg/ml) and Bbil-TX (210nM) caused minor changes in the compound action potential (CAP) amplitude recorded from sciatic nerve preparations, with no significant effect on rise time and latency; tetrodotoxin (3.1nM) blocked the CAP at the end of the experiments. In mouse triangularis sterni nerve-muscle (TSn-m) preparations, venom (10μg/ml) and Bbil-TX (210nM) significantly reduced the perineural waveform associated with the outward K(+) current while the amplitude of the inward Na(+) current was not significantly affected. Bbil-TX (210nM) caused a progressive increase in the quantal content of TSn-m preparations maintained in low Ca(2+) solution. Venom (3μg/ml) and toxin (210nM) increased the calcium fluorescence in SK-N-SH neuroblastoma cells loaded with Fluo3 AM and maintained in low or normal Ca(2+) solution. In normal Ca(2+), the increase in fluorescence amplitude was accompanied by irregular and frequent calcium transients. In TSn-m preparations loaded with Fluo4 AM, venom (10μg/ml) caused an immediate increase in intracellular Ca(2+) followed by oscillations in fluorescence and muscle contracture; Bbil-TX did not change the calcium fluorescence in TSn-m preparations. Immunohistochemical analysis of toxin-treated PND preparations revealed labeling of junctional ACh receptors but a loss of the presynaptic proteins synaptophysin and SNAP25. Together, these data confirm the presynaptic action of Bbil-TX and show that it involves modulation of K(+) channel activity and presynaptic protein expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new PLA2 (Bp-13) was purified from Bothrops pauloensis snake venom after a single chromatographic step of RP-HPLC on μ-Bondapak C-18. Amino acid analysis showed a high content of hydrophobic and basic amino acids and 14 half-cysteine residues. The N-terminal sequence showed a high degree of homology with basic Asp49 PLA2 myotoxins from other Bothrops venoms. Bp-13 showed allosteric enzymatic behavior and maximal activity at pH 8.1, 36°-45°C. Full Bp-13 PLA2 activity required Ca(2+); its PLA2 activity was inhibited by Mg(2+), Mn(2+), Sr(2+), and Cd(2+) in the presence and absence of 1 mM Ca(2+). In the mouse phrenic nerve-diaphragm (PND) preparation, the time for 50% paralysis was concentration-dependent (P < 0.05). Both the replacement of Ca(2+) by Sr(2+) and temperature lowering (24°C) inhibited the Bp-13 PLA2-induced twitch-tension blockade. Bp-13 PLA2 inhibited the contractile response to direct electrical stimulation in curarized mouse PND preparation corroborating its contracture effect. In biventer cervicis preparations, Bp-13 induced irreversible twitch-tension blockade and the KCl evoked contracture was partially, but significantly, inhibited (P > 0.05). The main effect of this new Asp49 PLA2 of Bothrops pauloensis venom is on muscle fiber sarcolemma, with avian preparation being less responsive than rodent preparation. The study enhances biochemical and pharmacological characterization of B. pauloensis venom.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In recent years, agronomical researchers began to cultivate several olive varieties in different regions of Brazil to produce virgin olive oil (VOO). Because there has been no reported data regarding the phenolic profile of the first Brazilian VOO, the aim of this work was to determine phenolic contents of these samples using rapid-resolution liquid chromatography coupled to electrospray ionisation time-of-flight mass spectrometry. 25 VOO samples from Arbequina, Koroneiki, Arbosana, Grappolo, Manzanilla, Coratina, Frantoio and MGS Mariense varieties from three different Brazilian states and two crops were analysed. It was possible to quantify 19 phenolic compounds belonging to different classes. The results indicated that Brazilian VOOs have high total phenolic content because the values were comparable with those from high-quality VOOs produced in other countries. VOOs from Coratina, Arbosana and Grappolo presented the highest total phenolic content. These data will be useful in the development and improvement of Brazilian VOO.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Culture supernatant of Staphylococcus aureus 722 in 3% triptone plus 1% yeast extract was used for EEA purification, proceeding comparison between dye ligand Red A affinity chromatography and classic chromatography. The capture of SEA with Amberlite CG-50 allowed rapid enterotoxin concentration from the culture supernatant. However, the ratio of 15 mg of the resin to a total of 150 mg of the toxin satured the resin, giving only 10 to 30% of SEA recuperation from the supernatant. The elution of concentrated material throught the Red A column resulted in a recovery of 60,87% of the toxin, and required 76 hours, indicating advantage on classic chromatography. Ion exchange column plus gel filtration recovered only 6,5 % of the SEA, and required 114 hours to conclude the procedure. The eletrophoresis of purified SEA indicated high grade of toxin obtained from Red A column, with 90 % of purity, compared to 60 % of classic column.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.