11 resultados para Rage Against the Machine

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Severe accidents caused by the armed spider Phoneutria nigriventer cause neurotoxic manifestations in victims. In experiments with rats, P. nigriventer venom (PNV) temporarily disrupts the properties of the BBB by affecting both the transcellular and the paracellular route. However, it is unclear how cells and/or proteins participate in the transient opening of the BBB. The present study demonstrates that PNV is a substrate for the multidrug resistance protein-1 (MRP1) in cultured astrocyte and endothelial cells (HUVEC) and increases mrp1 and cx43 and down-regulates glut1 mRNA transcripts in cultured astrocytes. The inhibition of nNOS by 7-nitroindazole suggests that NO derived from nNOS mediates some of these effects by either accentuating or opposing the effects of PNV. In vivo, MRP1, GLUT1 and Cx43 protein expression is increased differentially in the hippocampus and cerebellum, indicating region-related modulation of effects. PNV contains a plethora of Ca(2+), K(+) and Na(+) channel-acting neurotoxins that interfere with glutamate handling. It is suggested that the findings of the present study are the result of a complex interaction of signaling pathways, one of which is the NO, which regulates BBB-associated proteins in response to PNV interference on ions physiology. The present study provides additional insight into PNV-induced BBB dysfunction and shows that a protective mechanism is activated against the venom. The data shows that PNV has qualities for potential use in drug permeability studies across the BBB.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Basic phospholipases A2 (PLA2) are toxic and induce a wide spectrum of pharmacological effects, although the acidic enzyme types are not lethal or cause low lethality. Therefore, it is challenging to elucidate the mechanism of action of acidic phospholipases. This study used the acidic non-toxic Ba SpII RP4 PLA2 from Bothrops alternatus as an antigen to develop anti-PLA2 IgG antibodies in rabbits and used in vivo assays to examine the changes in crude venom when pre-incubated with these antibodies. Using Ouchterlony and western blot analyses on B. alternatus venom, we examined the specificity and sensitivity of phospholipase A2 recognition by the specific antibodies (anti-PLA2 IgG). Neutralisation assays using a non-toxic PLA2 antigen revealed unexpected results. The (indirect) haemolytic activity of whole venom was completely inhibited, and all catalytically active phospholipases A2 were blocked. Myotoxicity and lethality were reduced when the crude venom was pre-incubated with anti-PLA2 immunoglobulins. CK levels in the skeletal muscle were significantly reduced at 6 h, and the muscular damage was more significant at this time-point compared to 3 and 12 h. When four times the LD50 was used (224 μg), half the animals treated with the venom-anti PLA2 IgG mixture survived after 48 h. All assays performed with the specific antibodies revealed that Ba SpII RP4 PLA2 had a synergistic effect on whole-venom toxicity. IgG antibodies against the venom of the Argentinean species B. alternatus represent a valuable tool for elucidation of the roles of acidic PLA2 that appear to have purely digestive roles and for further studies on immunotherapy and snake envenoming in affected areas in Argentina and Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Lawsonia inermis mediated synthesis of silver nanoparticles (Ag-NPs) and its efficacy against Candida albicans, Microsporum canis, Propioniabacterium acne and Trichophyton mentagrophytes is reported. A two-step mechanism has been proposed for bioreduction and formation of an intermediate complex leading to the synthesis of capped nanoparticles was developed. In addition, antimicrobial gel for M. canis and T. mentagrophytes was also formulated. Ag-NPs were synthesized by challenging the leaft extract of L. inermis with 1 mM AgNO₃. The Ag-NPs were characterized by Ultraviolet-Visible (UV-Vis) spectrophotometer and Fourier transform infrared spectroscopy (FTIR). Transmission electron microscopy (TEM), nanoparticle tracking and analysis sytem (NTA) and zeta potential was measured to detect the size of Ag-NPs. The antimicrobial activity of Ag-NPs was evaluated by disc diffusion method against the test organisms. Thus these Ag-NPs may prove as a better candidate drug due to their biogenic nature. Moreover, Ag-NPs may be an answer to the drug-resistant microorganisms.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Caryocar brasiliense Camb (Pequi) is a typical Brazilian Cerrado fruit tree. Its fruit is used as a vitamin source for culinary purposes and as a source of oil for the manufacture of cosmetics. C. brasiliense supercritical CO2 extracts exhibit antimicrobial activity against the bacteria Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus and also possess antioxidant activity. This study was designed to evaluate the in vitro cytotoxicity and phototoxicity of the supercritical CO2 extract obtained from the leaves of this species. In vitro cytotoxicity and phototoxicity of C. brasiliense supercritical CO2 extracts were assessed using a tetrazolium-based colorimetric assay (XTT) and Neutral Red methods. We found that the C. brasiliense (Pequi) extract obtained by supercritical CO2 extraction did not present cytotoxic and phototoxic hazards. This finding suggests that the extract may be useful for the development of cosmetic and/or pharmaceutical products.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Isatin, an indole alkaloid has been shown to have anti-microbial, anti-tumor and anti-inflammatory effects. Due to its findings, we evaluated whether this alkaloid would have any effect on TNBS-induced colitis. Animals (male Unib:WH rats, aged 8 weeks old) were induced colitis through a rectal administration of 2,4,6-trinitrobenzene sulphonic acid using a catheter inserted 8 cm into the rectum of the animals. The rats were divided into two major groups: non-colitic and colitic. The colitic group was sub-divided into 6 groups (10 animals per group): colitic non-treated, Isatin 3; 6; 12.5; 18.75 and 25 mg/kg. Our main results showed that the oral treatment with Isatin 6 and 25 mg/kg were capable of avoiding the increase in TNF-α, COX-2 and PGE₂ levels when compared to the colitic non-treated group. Interestingly, the same doses (6 and 25 mg/kg) were also capable of preventing the decrease in IL-10 levels comparing with the colitic non-treated group. The levels of MPO, (an indirect indicator of neutrophil presence), were also maintained lower than those of the colitic non-treated group. Isatin also prevented the decrease of SOD activity and increase of GSH-Px and GSH-Rd activity as well as the depletion of GSH levels. In conclusion, both pre-treatments (6 and 25 mg/kg) were capable of protecting the gut mucosa against the injury caused by TNBS, through the combination of antioxidant and anti-inflammatory properties, which, together, showed a protective activity of the indole alkaloid Isatin.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this research was to investigate the antiproliferative and anticholinesterase activities of 11 extracts from 5 Annonaceae species in vitro. Antiproliferative activity was assessed using 10 human cancer cell lines. Thin-layer chromatography and a microplate assay were used to screen the extracts for acetylcholinesterase (AchE) inhibitors using Ellman's reagent. The chemical compositions of the active extracts were investigated using high performance liquid chromatography. Eleven extracts obtained from five Annonaceae plant species were active and were particularly effective against the UA251, NCI-470 lung, HT-29, NCI/ADR, and K-562 cell lines with growth inhibition (GI50) values of 0.04-0.06, 0.02-0.50, 0.01-0.12, 0.10-0.27, and 0.02-0.04 µg/mL, respectively. In addition, the Annona crassiflora and A. coriacea seed extracts were the most active among the tested extracts and the most effective against the tumor cell lines, with GI50 values below 8.90 µg/mL. The A. cacans extract displayed the lowest activity. Based on the microplate assay, the percent AchE inhibition of the extracts ranged from 12 to 52%, and the A. coriacea seed extract resulted in the greatest inhibition (52%). Caffeic acid, sinapic acid, and rutin were present at higher concentrations in the A. crassiflora seed samples. The A. coriacea seeds contained ferulic and sinapic acid. Overall, the results indicated that A. crassiflora and A. coriacea extracts have antiproliferative and anticholinesterase properties, which opens up new possibilities for alternative pharmacotherapy drugs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.