20 resultados para RHYNCHOSCIARA AMERICANA
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
• Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana.
Resumo:
Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.
Resumo:
No abstract available
Resumo:
to identify salient behavioral, normative, control and self-efficacy beliefs related to the behavior of adherence to oral antidiabetic agents, using the Theory of Planned Behavior. cross-sectional, exploratory study with 17 diabetic patients in chronic use of oral antidiabetic medication and in outpatient follow-up. Individual interviews were recorded, transcribed and content-analyzed using pre-established categories. behavioral beliefs concerning advantages and disadvantages of adhering to medication emerged, such as the possibility of avoiding complications from diabetes, preventing or delaying the use of insulin, and a perception of side effects. The children of patients and physicians are seen as important social references who influence medication adherence. The factors that facilitate adherence include access to free-of-cost medication and taking medications associated with temporal markers. On the other hand, a complex therapeutic regimen was considered a factor that hinders adherence. Understanding how to use medication and forgetfulness impact the perception of patients regarding their ability to adhere to oral antidiabetic agents. medication adherence is a complex behavior permeated by behavioral, normative, control and self-efficacy beliefs that should be taken into account when assessing determinants of behavior.
Resumo:
to assess the construct validity and reliability of the Pediatric Patient Classification Instrument. correlation study developed at a teaching hospital. The classification involved 227 patients, using the pediatric patient classification instrument. The construct validity was assessed through the factor analysis approach and reliability through internal consistency. the Exploratory Factor Analysis identified three constructs with 67.5% of variance explanation and, in the reliability assessment, the following Cronbach's alpha coefficients were found: 0.92 for the instrument as a whole; 0.88 for the Patient domain; 0.81 for the Family domain; 0.44 for the Therapeutic procedures domain. the instrument evidenced its construct validity and reliability, and these analyses indicate the feasibility of the instrument. The validation of the Pediatric Patient Classification Instrument still represents a challenge, due to its relevance for a closer look at pediatric nursing care and management. Further research should be considered to explore its dimensionality and content validity.
Resumo:
to assess how nurses perceive autonomy, control over the environment, the professional relationship between nurses and physicians and the organizational support and correlate them with burnout, satisfaction at work, quality of work and the intention to quit work in primary healthcare. cross-sectional and correlation study, using a sample of 198 nurses. The tools used were the Nursing Work Index Revised, Maslach Burnout Inventory and a form to characterize the nurses. To analyze the data, descriptive statistics were applied and Spearman's correlation coefficient was used. the nurses assessed that the environment is partially favorable for: autonomy, professional relationship and organizational support and that the control over this environment is limited. Significant correlations were evidenced between the Nursing Work Index Revised, Maslach Burnout Inventory and the variables: satisfaction at work, quality of care and the intent to quit the job. the nurses' perceptions regarding the environment of practice are correlated with burnout, satisfaction at work, quality of care and the intent to quit the job. This study provides support for the restructuring of work processes in the primary health care environment and for communication among the health service management, human resources and occupational health areas.
Resumo:
to analyze the factors associated with the underreporting on the part of nurses within Primary Health Care of abuse against children and adolescents. cross-sectional study with 616 nurses. A questionnaire addressed socio-demographic data, profession, instrumentation and knowledge on the topic, identification and reporting of abuse cases. Bivariate and multivariate logistic regression was used. female nurses, aged between 21 and 32 years old, not married, with five or more years since graduation, with graduate studies, and working for five or more years in PHC predominated. The final regression model showed that factors such as working for five or more years, having a reporting form within the PHC unit, and believing that reporting within Primary Health Care is an advantage, facilitate reporting. the study's results may, in addition to sensitizing nurses, support management professionals in establishing strategies intended to produce compliance with reporting as a legal device that ensures the rights of children and adolescents.
Resumo:
one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.
Resumo:
to compare the general and specific health-related quality of life (HRQoL) between the Intervention (IG) and Control (CG) groups of coronary artery disease patients after the implementation of Action Planning and Coping Planning strategies for medication adherence and to verify the relationship between adherence and HRQoL. this was a controlled and randomized study. the sample (n=115) was randomized into two groups, IG (n=59) and CG (n=56). Measures of medication adherence and general and specific HRQoL were obtained in the baseline and after two months of monitoring. the findings showed that the combination of intervention strategies - Action Planning and Coping Planning for medication adherence did not affect the HRQoL of coronary artery disease patients in outpatient monitoring.
Resumo:
The main objective of this work is to discuss the notion of metalanguage concerning the use of thesaurus (symbols systems, functions indicators, descriptors) utilized by indexers for article representation in computerized bibliographical databases. Our corpus comprises article abstracts and bibliographical database descriptors LILACS (Literatura Latino-Americana em Ciências da Saúde) and SOCIOFILE Sociological Abstracts. We aim at clarifying the effects of subjectivity in the functioning of indexing taking account the grounds for interpretation that allow different meanings.
Resumo:
The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Purpose: To identify improvement in visual performance of low vision students after assessment and management conducted at the Low Vision Service of State University of Campinas (UNICAMP). Method: Fourteen low vision students aged six to 30 years, attended in a room with resources for visual deficiency in Americana and Santa Bárbara d'Oeste -- SP during 1998 received complete ophthalmologic examination, specialized low vision assessment and educational intervention. Results: The most prevalent cause of vision loss was operated congenital cataract with four cases (28.6%), followed by congenital bilateral toxoplasmic macular scars and eye malformation, both with two cases (14.3%) cases each. Eight students (57.2%) had acuity classified as severe vision loss, four (28.6%) profound, one (7.1%) moderate and one (7.1%) nearly normal vision. Twelve (85.7%) were behind expected school grade. Optical aids were prescribed for 12 (85.8%) students but only 7 (58.3%) acquired the aids thus improving significantly their school performance. Conclusion: All students improved school performance even considering that 12 (85.7%) had severe to profound vision loss. As a group their performance could even be better if the optical aid prescriptions were acquired by all. This indicates the need of a social work to support such needs. For good results at school and effective student inclusion a partnership between school, family and specialized education is necessary. We recommend to promote the benefits of the resource room.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física