13 resultados para REVERSE MICROEMULSION
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.
Resumo:
Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.
Resumo:
Intermittent fasting (IF) is an often-used intervention to decrease body mass. In male Sprague-Dawley rats, 24 hour cycles of IF result in light caloric restriction, reduced body mass gain, and significant decreases in the efficiency of energy conversion. Here, we study the metabolic effects of IF in order to uncover mechanisms involved in this lower energy conversion efficiency. After 3 weeks, IF animals displayed overeating during fed periods and lower body mass, accompanied by alterations in energy-related tissue mass. The lower efficiency of energy use was not due to uncoupling of muscle mitochondria. Enhanced lipid oxidation was observed during fasting days, whereas fed days were accompanied by higher metabolic rates. Furthermore, an increased expression of orexigenic neurotransmitters AGRP and NPY in the hypothalamus of IF animals was found, even on feeding days, which could explain the overeating pattern. Together, these effects provide a mechanistic explanation for the lower efficiency of energy conversion observed. Overall, we find that IF promotes changes in hypothalamic function that explain differences in body mass and caloric intake.
Resumo:
Lutein (LT) is a carotenoid obtained by diet and despite its antioxidant activity had been biochemically reported, few studies are available concerning its influence on the expression of antioxidant genes. The expression of 84 genes implicated in antioxidant defense was quantified using quantitative reverse transcription polymerase chain reaction array. DNA damage was measured by comet assay and glutathione (GSH) and thiobarbituric acid reactive substances (TBARS) were quantified as biochemical parameters of oxidative stress in mouse kidney and liver. cDDP treatment reduced concentration of GSH and increased TBARS, parameters that were ameliorated in treatment associated with LT. cDDP altered the expression of 32 genes, increasing the expression of GPx2, APC, Nqo1 and CCs. LT changed the expression of 37 genes with an induction of 13 mainly oxygen transporters. In treatments associating cDDP and LT, 30 genes had their expression changed with a increase of the same genes of the cDDP treatment alone. These results suggest that LT might act scavenging reactive species and also inducing the expression of genes related to a better antioxidant response, highlighting the improvement of oxygen transport. This improved redox state of the cell through LT treatment could be related to the antigenotoxic and antioxidant effects observed.
Resumo:
Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.
Resumo:
Obesity is currently considered a major public health problem in the world, already reaching epidemic characteristics, according to the World Health Organization. Excess weight is the major risk factor associated with various diseases, such as type 2 diabetes mellitus, hypertension, dyslipidemia and osteometabolic diseases, including osteoporosis and osteoarthritis. Osteoarthritis is the most prevalent rheumatic disease and the leading cause of physical disability and reduced quality of life of the population over 65 years. It mainly involves the joints that bear weight - knees and hips. However, along with the cases of obesity, its prevalence is increasing, and even in other joints, such as hands. Thus, it is assumed that the influence of obesity on the development of OA is beyond mechanical overload. The purpose of this review was to correlate the possible mechanisms underlying the genesis and development of these two diseases. Increased fat mass is directly proportional to excessive consumption of saturated fatty acids, responsible for systemic low-grade inflammation condition and insulin and leptin resistance. At high levels, leptin assumes inflammatory characteristics and acts in the articular cartilage, triggering the inflammatory process and changing homeostasis this tissue with consequent degeneration. We conclude that obesity is a risk factor for osteoarthritis and that physical activity and changes in diet composition can reverse the inflammatory and leptin resistance, reducing progression or preventing the onset of osteoarthritis.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The local anesthetic effects on neuromuscular junction and its influence on blockade produced by nondepolarizing neuromuscular blockers are still under-investigated; however, this interaction has been described in experimental studies and in humans. The aim of this study was to evaluate in vitro the interaction between ropivacaine and pancuronium, the influence on transmission and neuromuscular blockade, and the effectiveness of neostigmine and 4-aminopyridine to reverse the blockade. Rats were divided into groups (n=5) according to the study drug: ropivacaine (5μgmL(-1)); pancuronium (2μg.mL(-1)); ropivacaine+pancuronium. Neostigmine and 4-aminopyridine were used at concentrations of 2μgmL(-1) and 20μgmL(-1), respectively. The effects of ropivacaine on membrane potential and miniature end-plate potential, the amplitude of diaphragm responses before and 60minutes after the addition of ropivacaine (degree of neuromuscular blockade with pancuronium and with the association of pancuronium-ropivacaine), and the effectiveness of neostigmine and 4-aminopyridine on neuromuscular block reversal were evaluated. Ropivacaine did not alter the amplitude of muscle response (the membrane potential), but decreased the frequency and amplitude of the miniature end-plate potential. Pancuronium blockade was potentiated by ropivacaine, and partially and fully reversed by neostigmine and 4-aminopyridine, respectively. Ropivacaine increased the neuromuscular block produced by pancuronium. The complete antagonism with 4-aminopyridine suggests presynaptic action of ropivacaine.
Resumo:
To compare the hemodynamic changes following two different lipid emulsion therapies after bupivacaine intoxication in swines. Large White pigs were anesthetized with thiopental, tracheal intubation performed and mechanical ventilation instituted. Hemodynamic variables were recorded with invasive pressure monitoring and pulmonary artery catheterization (Swan-Ganz catheter). After a 30-minute resting period, 5 mg.kg-1 of bupivacaine by intravenous injection was administered and new hemodynamic measures were performed 1 minute later; the animals were than randomly divided into three groups and received 4 ml.kg-1 of one of the two different lipid emulsion with standard long-chaim triglyceride, or mixture of long and medium-chain triglyceride, or saline solution. Hemodynamic changes were then re-evaluated at 5, 10, 15, 20 and 30 minutes. Bupivacaine intoxication caused fall in arterial blood pressure, cardiac index, ventricular systolic work index mainly and no important changes in vascular resistances. Both emulsion improved arterial blood pressure mainly increasing vascular resistance since the cardiac index had no significant improvement. On the systemic circulation the hemodynamic results were similar with both lipid emulsions. Both lipid emulsions were efficient and similar options to reverse hypotension in cases of bupivacaine toxicity.
Resumo:
G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.
Resumo:
Chronic ethanol consumption leads to reproductive damages, since it can act directly in the tissues or indirectly, causing a hormonal imbalance. Prostate is a hormone-dependent gland and, consequently, susceptible to ethanol. The potential of testosterone therapy in the ethanol-related disorders was investigated in the prostate microenvironment. UChB rats aged 90 days were divided into 2 experimental groups (n=20): C: drinking water only and EtOH: drinking 10% (v/v) ethanol at >2 g/kg body weight/day+water. At 150 days old, 10 rats from each group received subcutaneous injections of testosterone cypionate (5 mg/kg body weight) diluted in corn oil every other day for 4 weeks, constituting T and EtOH+T, while the remaining animals received corn oil as vehicle. Animals were euthanized at 180 days old, by decapitation. Blood was collected to obtain hormone concentrations and ventral prostate was dissected and processed for light microscope and molecular analyses. Ventral prostate weight, plasma testosterone and DHT and intraprostatic testosterone concentrations were increased after testosterone treatment. Plasma estradiol level was reduced in the EtOH+T. Inflammatory foci, metaplasia and epithelial atrophy were constantly found in the prostate of EtOH and were not observed after hormonal therapy. No differences were found in the expression of AR, ERβ and DACH-1. Additionally, testosterone treatment down-regulated ERα and increased the e-cadherin and α-actinin immunoreactivities. Testosterone was able to reverse damages caused by ethanol consumption in the prostate microenvironment and becomes a possible target to be investigated to ethanol-related disorders.
Resumo:
Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.