12 resultados para Prostatic Specific Antigen
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
To assess total testosterone and prostatic-specific antigen (PSA) kinetics among diverse chemical castrations, advanced-stage prostate cancer patients were randomized into three groups of 20: Group 1, Leuprolide 3.75 mg; Group 2, Leuprolide 7.5 mg; and Group 3, Goserelin 3.6 mg. All groups were treated with monthly application of the respective drugs. The patients' levels of serum total testosterone and PSA were evaluated at two time periods: before the treatment and 3 months after the treatment. Spearman's rank correlation coefficient was utilized to verify the hypothesis of linear correlation between total testosterone and PSA levels. At the beginning the patients' age, stage, grade, PSA, and total testosterone were similar within the three groups, with median age 72, 70, and 70 years in Groups 1, 2, and 3, respectively. Three months after the treatment, patients who received Leuprolide 7.5 mg presented significantly lower median total testosterone levels compared with Goserelin 3.6 mg and Leuprolide 3.75 mg (9.5 ng/dL vs. 20.0 ng/dL vs. 30.0 ng/dL, respectively; p = .0072), while those who received Goserelin 3.6 mg presented significantly lower PSA levels compared with Leuprolide 7.5 mg and Leuprolide 3.75 mg (0.67 vs. 1.86 vs. 2.57, respectively; p = .0067). There was no linear correlation between total testosterone and PSA levels. Overall, regarding castration levels of total testosterone, 28.77% of patients did not obtain levels ≤50 ng/dL and 47.80% did not obtain levels ≤20 ng/dL. There was no correlation between total testosterone and PSA kinetics and no equivalence among different pharmacological castrations.
Resumo:
To compare time and risk to biochemical recurrence (BR) after radical prostatectomy of two chronologically different groups of patients using the standard and the modified Gleason system (MGS). Cohort 1 comprised biopsies of 197 patients graded according to the standard Gleason system (SGS) in the period 1997/2004, and cohort 2, 176 biopsies graded according to the modified system in the period 2005/2011. Time to BR was analyzed with the Kaplan-Meier product-limit analysis and prediction of shorter time to recurrence using univariate and multivariate Cox proportional hazards model. Patients in cohort 2 reflected time-related changes: striking increase in clinical stage T1c, systematic use of extended biopsies, and lower percentage of total length of cancer in millimeter in all cores. The MGS used in cohort 2 showed fewer biopsies with Gleason score ≤ 6 and more biopsies of the intermediate Gleason score 7. Time to BR using the Kaplan-Meier curves showed statistical significance using the MGS in cohort 2, but not the SGS in cohort 1. Only the MGS predicted shorter time to BR on univariate analysis and on multivariate analysis was an independent predictor. The results favor that the 2005 International Society of Urological Pathology modified system is a refinement of the Gleason grading and valuable for contemporary clinical practice.
Resumo:
To detect the presence of male DNA in vaginal samples collected from survivors of sexual violence and stored on filter paper. A pilot study was conducted to evaluate 10 vaginal samples spotted on sterile filter paper: 6 collected at random in April 2009 and 4 in October 2010. Time between sexual assault and sample collection was 4-48hours. After drying at room temperature, the samples were placed in a sterile envelope and stored for 2-3years until processing. DNA extraction was confirmed by polymerase chain reaction for human β-globin, and the presence of prostate-specific antigen (PSA) was quantified. The presence of the Y chromosome was detected using primers for sequences in the TSPY (Y7/Y8 and DYS14) and SRY genes. β-Globin was detected in all 10 samples, while 2 samples were positive for PSA. Half of the samples amplified the Y7/Y8 and DYS14 sequences of the TSPY gene and 30% amplified the SRY gene sequence of the Y chromosome. Four male samples and 1 female sample served as controls. Filter-paper spots stored for periods of up to 3years proved adequate for preserving genetic material from vaginal samples collected following sexual violence.
Resumo:
Background. Benign prostatic hyperplasia (BPH) pharmacological treatment may promote a decrease in prostate vascularization and bladder neck relaxation with theoretical improvement in prostate biopsy morbidity, though never explored in the literature. Methods. Among 242 consecutive unselected patients who underwent prostate biopsy, after excluding those with history of prostate biopsy/surgery or using medications not for BPH, we studied 190 patients. On the 15th day after procedure patients were questioned about symptoms lasting over a week and classified according to pharmacological BPH treatment. Results. Thirty-three patients (17%) were using alpha-blocker exclusively, five (3%) 5-alpha-reductase inhibitor exclusively, twelve (6%) patients used both medications, and 140 (74%) patients used none. There was no difference in regard to age among groups (P = 0.5). Postbiopsy adverse effects occurred as follows: hematuria 96 (50%), hematospermia 53 (28%), hematochezia 22 (12%), urethrorrhagia 19 (10%), fever 5 (3%), and pain 20 (10%). There was a significant negative correlation between postbiopsy hematuria and BPH pharmacological treatment with stronger correlation for combined use of 5-alpha-reductase inhibitor and alpha-blocker over 6 months (P = 0.0027). Conclusion. BPH pharmacological treatment, mainly combined for at least 6 months seems to protect against prostate biopsy adverse effects. Future studies are necessary to confirm our novel results.
Resumo:
Basic phospholipases A2 (PLA2) are toxic and induce a wide spectrum of pharmacological effects, although the acidic enzyme types are not lethal or cause low lethality. Therefore, it is challenging to elucidate the mechanism of action of acidic phospholipases. This study used the acidic non-toxic Ba SpII RP4 PLA2 from Bothrops alternatus as an antigen to develop anti-PLA2 IgG antibodies in rabbits and used in vivo assays to examine the changes in crude venom when pre-incubated with these antibodies. Using Ouchterlony and western blot analyses on B. alternatus venom, we examined the specificity and sensitivity of phospholipase A2 recognition by the specific antibodies (anti-PLA2 IgG). Neutralisation assays using a non-toxic PLA2 antigen revealed unexpected results. The (indirect) haemolytic activity of whole venom was completely inhibited, and all catalytically active phospholipases A2 were blocked. Myotoxicity and lethality were reduced when the crude venom was pre-incubated with anti-PLA2 immunoglobulins. CK levels in the skeletal muscle were significantly reduced at 6 h, and the muscular damage was more significant at this time-point compared to 3 and 12 h. When four times the LD50 was used (224 μg), half the animals treated with the venom-anti PLA2 IgG mixture survived after 48 h. All assays performed with the specific antibodies revealed that Ba SpII RP4 PLA2 had a synergistic effect on whole-venom toxicity. IgG antibodies against the venom of the Argentinean species B. alternatus represent a valuable tool for elucidation of the roles of acidic PLA2 that appear to have purely digestive roles and for further studies on immunotherapy and snake envenoming in affected areas in Argentina and Brazil.
Resumo:
This study aimed to identify novel biomarkers for thyroid carcinoma diagnosis and prognosis. We have constructed a human single-chain variable fragment (scFv) antibody library that was selected against tumour thyroid cells using the BRASIL method (biopanning and rapid analysis of selective interactive ligands) and phage display technology. One highly reactive clone, scFv-C1, with specific binding to papillary thyroid tumour proteins was confirmed by ELISA, which was further tested against a tissue microarray that comprised of 229 thyroid tissues, including: 110 carcinomas (38 papillary thyroid carcinomas (PTCs), 42 follicular carcinomas, 30 follicular variants of PTC), 18 normal thyroid tissues, 49 nodular goitres (NG) and 52 follicular adenomas. The scFv-C1 was able to distinguish carcinomas from benign lesions (P=0.0001) and reacted preferentially against T1 and T2 tumour stages (P=0.0108). We have further identified an OTU domain-containing protein 1, DUBA-7 deubiquitinating enzyme as the scFv-binding antigen using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. The strategy of screening and identifying a cell-surface-binding antibody against thyroid tissues was highly effective and resulted in a useful biomarker that recognises malignancy among thyroid nodules and may help identify lower-risk cases that can benefit from less-aggressive management.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
Aging is considered one of the main predisposing factors for the development of prostate malignancies. Angiogenesis is fundamental for tumor growth and its inhibition represents a promising therapeutic approach in cancer treatment. Thus, we sought to determine angiogenic responses and the effects of antiangiogenic therapy in the mouse prostate during late life, comparing these findings with the prostatic microenvironment in the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. Male mice (52 week-old FVB) were submitted to treatments with SU5416 (6 mg/kg; i.p.) and/or TNP-470 (15 mg/kg; s.c.). Finasteride was administered (20 mg/kg; s.c.), alone or in association to both inhibitors. The dorsolateral prostate was collected for VEGF, HIF-1α, FGF-2 and endostatin immunohistochemical and Western Blotting analyses and for microvessel density (MVD) count. Senescence led to increased MVD and VEGF, HIF-1α and FGF-2 protein levels in the prostatic microenvironment, similarly to what was observed in TRAMP mice prostate. The angiogenic process was impaired in all the treated groups, demonstrating significantly decreased MVD. Antiangiogenic and/or finasteride treatments resulted in decreased VEGF and HIF-1α levels, especially following TNP-470 administration, either alone or associated to SU5416. The combination of these agents resulted in increased endostatin levels, regardless of the presence of finasteride. Prostatic angiogenesis stimulation during senescence favored the development of neoplastic lesions, considering the pro-angiogenic microenvironment as a common aspect also observed during cancer progression in TRAMP mice. The combined antiangiogenic therapy was more efficient, leading to enhanced imbalance towards angiogenic inhibition in the organ. Finally, finasteride administration might secondarily upregulate the expression of pro-angiogenic factors, pointing to the harmful effects of this therapy. Prostate 75: 484-499, 2015. © 2014 Wiley Periodicals, Inc.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.