16 resultados para Power Line Detection

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To verify whether fluorescence in situ hybridization (FISH) of cells from the buccal epithelium could be employed to detect cryptomosaicism with a 45,X lineage in 46,XY patients. Samples of nineteen 46,XY healthy young men and five patients with disorders of sex development (DSD), four 45,X/46,XY and one 46,XY were used. FISH analysis with X and Y specific probes on interphase nuclei from blood lymphocytes and buccal epithelium were analyzed to investigate the proportion of nuclei containing only the signal of the X chromosome. The frequency of nuclei containing only the X signal in the two tissues of healthy men did not differ (p = 0.69). In all patients with DSD this frequency was significantly higher, and there was no difference between the two tissues (p = 0.38), either. Investigation of mosaicism with a 45,X cell line in patients with 46,XY DSD or sterility can be done by FISH directly using cells from the buccal epithelium.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plackett-Burman experimental design was applied for the robustness assessment of GC×GC-qMS (Comprehensive Two-Dimensional Gas Chromatography with Fast Quadrupolar Mass Spectrometric Detection) in quantitative and qualitative analysis of volatiles compounds from chocolate samples isolated by headspace solid-phase microextraction (HS-SPME). The influence of small changes around the nominal level of six factors deemed as important on peak areas (carrier gas flow rate, modulation period, temperature of ionic source, MS photomultiplier power, injector temperature and interface temperature) and of four factors considered as potentially influential on spectral quality (minimum and maximum limits of the scanned mass ranges, ions source temperature and photomultiplier power). The analytes selected for the study were 2,3,5-trimethylpyrazine, 2-octanone, octanal, 2-pentyl-furan, 2,3,5,6-tetramethylpyrazine, and 2-nonanone e nonanal. The factors pointed out as important on the robustness of the system were photomultiplier power for quantitative analysis and lower limit of mass scanning range for qualitative analysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, the transmission-line modeling (TLM) applied to bio-thermal problems was improved by incorporating several novel computational techniques, which include application of graded meshes which resulted in 9 times faster in computational time and uses only a fraction (16%) of the computational resources used by regular meshes in analyzing heat flow through heterogeneous media. Graded meshes, unlike regular meshes, allow heat sources to be modeled in all segments of the mesh. A new boundary condition that considers thermal properties and thus resulting in a more realistic modeling of complex problems is introduced. Also, a new way of calculating an error parameter is introduced. The calculated temperatures between nodes were compared against the results obtained from the literature and agreed within less than 1% difference. It is reasonable, therefore, to conclude that the improved TLM model described herein has great potential in heat transfer of biological systems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Riboflavin (vitamin B2) is a precursor for coenzymes involved in energy production, biosynthesis, detoxification, and electron scavenging. Previously, we demonstrated that irradiated riboflavin (IR) has potential antitumoral effects against human leukemia cells (HL60), human prostate cancer cells (PC3), and mouse melanoma cells (B16F10) through a common mechanism that leads to apoptosis. Hence, we here investigated the effect of IR on 786-O cells, a known model cell line for clear cell renal cell carcinoma (CCRCC), which is characterized by high-risk metastasis and chemotherapy resistance. IR also induced cell death in 786-O cells by apoptosis, which was not prevented by antioxidant agents. IR treatment was characterized by downregulation of Fas ligand (TNF superfamily, member 6)/Fas (TNF receptor superfamily member 6) (FasL/Fas) and tumor necrosis factor receptor superfamily, member 1a (TNFR1)/TNFRSF1A-associated via death domain (TRADD)/TNF receptor-associated factor 2 (TRAF) signaling pathways (the extrinsic apoptosis pathway), while the intrinsic apoptotic pathway was upregulated, as observed by an elevated Bcl-2 associated x protein/B-cell CLL/lymphoma 2 (Bax/Bcl-2) ratio, reduced cellular inhibitor of apoptosis 1 (c-IAP1) expression, and increased expression of apoptosis-inducing factor (AIF). The observed cell death was caspase-dependent as proven by caspase 3 activation and poly(ADP-ribose) polymerase-1 (PARP) cleavage. IR-induced cell death was also associated with downregulation of v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (avian)/protein serine/threonine kinase B/extracellular signal-regulated protein kinase 1/2 (Src/AKT/ERK1/2) pathway and activation of p38 MAP kinase (p38) and Jun-amino-terminal kinase (JNK). Interestingly, IR treatment leads to inhibition of matrix metalloproteinase-2 (MMP-2) activity and reduced expression of renal cancer aggressiveness markers caveolin-1, low molecular weight phosphotyrosine protein phosphatase (LMWPTP), and kinase insert domain receptor (a type III receptor tyrosine kinase) (VEGFR-2). Together, these results show the potential of IR for treating cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física