8 resultados para Position of the fruit in the canopy

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The models of teaching social sciences and clinical practice are insufficient for the needs of practical-reflective teaching of social sciences applied to health. The scope of this article is to reflect on the challenges and perspectives of social science education for health professionals. In the 1950s the important movement bringing together social sciences and the field of health began, however weak credentials still prevail. This is due to the low professional status of social scientists in health and the ill-defined position of the social sciences professionals in the health field. It is also due to the scant importance attributed by students to the social sciences, the small number of professionals and the colonization of the social sciences by the biomedical culture in the health field. Thus, the professionals of social sciences applied to health are also faced with the need to build an identity, even after six decades of their presence in the field of health. This is because their ambivalent status has established them as a partial, incomplete and virtual presence, requiring a complex survival strategy in the nebulous area between social sciences and health.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The arboreal ant Odontomachus hastatus nests among roots of epiphytic bromeliads in the sandy forest at Cardoso Island (Brazil). Crepuscular and nocturnal foragers travel up to 8m to search for arthropod prey in the canopy, where silhouettes of leaves and branches potentially provide directional information. We investigated the relevance of visual cues (canopy, horizon patterns) during navigation in O. hastatus. Laboratory experiments using a captive ant colony and a round foraging arena revealed that an artificial canopy pattern above the ants and horizon visual marks are effective orientation cues for homing O. hastatus. On the other hand, foragers that were only given a tridimensional landmark (cylinder) or chemical marks were unable to home correctly. Navigation by visual cues in O. hastatus is in accordance with other diurnal arboreal ants. Nocturnal luminosity (moon, stars) is apparently sufficient to produce contrasting silhouettes from the canopy and surrounding vegetation, thus providing orientation cues. Contrary to the plain floor of the round arena, chemical cues may be important for marking bifurcated arboreal routes. This experimental demonstration of the use of visual cues by a predominantly nocturnal arboreal ant provides important information for comparative studies on the evolution of spatial orientation behavior in ants. This article is part of a Special Issue entitled: Neotropical Behaviour.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Genipap fruits, native to the Amazon region, were classified in relation to their stage of ripeness according to firmness and peel color. The influence of the part of the genipap fruit and ripeness stage on the iridoid and phenolic compound profiles was evaluated by HPLC-DAD-MS(n), and a total of 17 compounds were identified. Geniposide was the major compound in both parts of the unripe genipap fruits, representing >70% of the total iridoids, whereas 5-caffeoylquinic acid was the major phenolic compound. In ripe fruits, genipin gentiobioside was the major compound in the endocarp (38%) and no phenolic compounds were detected. During ripening, the total iridoid content decreased by >90%, which could explain the absence of blue pigment formation in the ripe fruits after their injury. This is the first time that the phenolic compound composition and iridoid contents of genipap fruits have been reported in the literature.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mutations in the FGFR3 gene cause the phenotypic spectrum of FGFR3 chondrodysplasias ranging from lethal forms to the milder phenotype seen in hypochondroplasia (Hch). The p.N540K mutation in the FGFR3 gene occurs in ∼70% of individuals with Hch, and nearly 30% of individuals with the Hch phenotype have no mutations in the FGFR3, which suggests genetic heterogeneity. The identification of a severe case of Hch associated with the typical mutation c.1620C > A and the occurrence of a c.1150T > C change that resulted in a p.F384L in exon 10, together with the suspicion that this second change could be a modulator of the phenotype, prompted us to investigate this hypothesis in a cohort of patients. An analysis of 48 patients with FGFR3 chondrodysplasia phenotypes and 330 healthy (control) individuals revealed no significant difference in the frequency of the C allele at the c.1150 position (p = 0.34). One patient carrying the combination `pathogenic mutation plus the allelic variant c.1150T > C' had a typical achondroplasia (Ach) phenotype. In addition, three other patients with atypical phenotypes showed no association with the allelic variant. Together, these results do not support the hypothesis of a modulatory role for the c.1150T > C change in the FGFR3 gene.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.