5 resultados para Percutaneous Penetration
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The development and maintenance of the sealing of the root canal system is the key to the success of root canal treatment. The resin-based adhesive material has the potential to reduce the microleakage of the root canal because of its adhesive properties and penetration into dentinal walls. Moreover, the irrigation protocols may have an influence on the adhesiveness of resin-based sealers to root dentin. The objective of the present study was to evaluate the effect of different irrigant protocols on coronal bacterial microleakage of gutta-percha/AH Plus and Resilon/Real Seal Self-etch systems. One hundred ninety pre-molars were used. The teeth were divided into 18 experimental groups according to the irrigation protocols and filling materials used. The protocols used were: distilled water; sodium hypochlorite (NaOCl)+eDTA; NaOCl+H3PO4; NaOCl+eDTA+chlorhexidine (CHX); NaOCl+H3PO4+CHX; CHX+eDTA; CHX+ H3PO4; CHX+eDTA+CHX and CHX+H3PO4+CHX. Gutta-percha/AH Plus or Resilon/Real Seal Se were used as root-filling materials. The coronal microleakage was evaluated for 90 days against Enterococcus faecalis. Data were statistically analyzed using Kaplan-Meier survival test, Kruskal-Wallis and Mann-Whitney tests. No significant difference was verified in the groups using chlorhexidine or sodium hypochlorite during the chemo-mechanical preparation followed by eDTA or phosphoric acid for smear layer removal. The same results were found for filling materials. However, the statistical analyses revealed that a final flush with 2% chlorhexidine reduced significantly the coronal microleakage. A final flush with 2% chlorhexidine after smear layer removal reduces coronal microleakage of teeth filled with gutta-percha/AH Plus or Resilon/Real Seal SE.
Resumo:
This paper presents two techniques to evaluate soil mechanical resistance to penetration as an auxiliary method to help in a decision-making in subsoiling operations. The decision is based on the volume of soil mobilized as a function of the considered critical soil resistance to penetration in each case. The first method, probabilistic, uses statistical techniques to define the volume of soil to be mobilized. The other method, deterministic, determines the percentage of soil to be mobilized and its spatial distribution. Both cases plot the percentage curves of experimental data related to the soil mechanical resistance to penetration equal or larger to the established critical level and the volume of soil to be mobilized as a function of critical level. The deterministic method plots showed the spatial distribution of the data with resistance to penetration equal or large than the critical level. The comparison between mobilized soil curves as a function of critical level using both methods showed that they can be considered equivalent. The deterministic method has the advantage of showing the spatial distribution of the critical points.
Resumo:
This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física