Relationship Between Lower-limb Muscle Strength And Functional Independence Among Elderly People According To Frailty Criteria: A Cross-sectional Study.

Muscle strength and functional independence are considered to be determinants of frailty levels among elderly people. The aim here was to compare lower-limb muscle strength (LLMS) with functional independence in relation to sex, age and number of frailty criteria, and to ascertain the influence of these variables on elderly outpatients' independence. Quantitative cross-sectional study, in a tertiary hospital. The study was conducted on 150 elderly outpatients of both sexes who were in a cognitive condition allowing oral communication, between October 2005 and October 2007. The following instruments were used: five-times sit-to-stand test (FTSST), Functional Independence Measurement (FIM) and Lawton's Instrumental Activities of Daily Living Scale (IADL). Descriptive, comparative, multivariate, univariate and Cronbach alpha analyses were performed. The mean time taken in the FTSST was 21.7 seconds; the mean score for FIM was 82.2 and for IADL was 21.2; 44.7% of the subjects presented 1-2 frailty criteria and 55.3% > 3 criteria. There was a significant association between LLMS and functional independence in relation to the number of frailty criteria, without homogeneity regarding sex and age. Functional independence showed significant influence from sex and LLMS. Elderly individuals with 1 or 2 frailty criteria presented greater independence in all FTSST scores. The subjects with higher LLMS presented better functional independence.

Cluster Analysis To Identify Elderly People's Profiles: A Healthcare Strategy Based On Frailty Characteristics.

The new social panorama resulting from aging of the Brazilian population is leading to significant transformations within healthcare. Through the cluster analysis strategy, it was sought to describe the specific care demands of the elderly population, using frailty components. Cross-sectional study based on reviewing medical records, conducted in the geriatric outpatient clinic, Hospital de Clínicas, Universidade Estadual de Campinas (Unicamp). Ninety-eight elderly users of this clinic were evaluated using cluster analysis and instruments for assessing their overall geriatric status and frailty characteristics. The variables that most strongly influenced the formation of clusters were age, functional capacities, cognitive capacity, presence of comorbidities and number of medications used. Three main groups of elderly people could be identified: one with good cognitive and functional performance but with high prevalence of comorbidities (mean age 77.9 years, cognitive impairment in 28.6% and mean of 7.4 comorbidities); a second with more advanced age, greater cognitive impairment and greater dependence (mean age 88.5 years old, cognitive impairment in 84.6% and mean of 7.1 comorbidities); and a third younger group with poor cognitive performance and greater number of comorbidities but functionally independent (mean age 78.5 years old, cognitive impairment in 89.6% and mean of 7.4 comorbidities). These data characterize the profile of this population and can be used as the basis for developing efficient strategies aimed at diminishing functional dependence, poor self-rated health and impaired quality of life.

Self-reported Diabetes In Older People: Comparison Of Prevalences And Control Measures.

The objective of this study was to analyze the prevalence of diabetes in older people and the adopted control measures. Data regarding older diabetic individuals who participated in the Health Surveys conducted in the Municipality of Sao Paulo, SP, ISA-Capital, in 2003 and 2008, which were cross-sectional studies, were analyzed. Prevalences and confidence intervals were compared between 2003 and 2008, according to sociodemographic variables. The combination of the databases was performed when the confidence intervals overlapped. The Chi-square (level of significance of 5%) and the Pearson's Chi-square (Rao-Scott) tests were performed. The variables without overlap between the confidence intervals were not tested. The age of the older adults was 60-69 years. The majority were women, Caucasian, with an income of between > 0.5 and 2.5 times the minimum salary and low levels of schooling. The prevalence of diabetes was 17.6% (95%CI 14.9;20.6) in 2003 and 20.1% (95%CI 17.3;23.1) in 2008, which indicates a growth over this period (p at the limit of significance). The most prevalent measure adopted by the older adults to control diabetes was hypoglycemic agents, followed by diet. Physical activity was not frequent, despite the significant differences observed between 2003 and 2008 results. The use of public health services to control diabetes was significantly higher in older individuals with lower income and lower levels of education. Diabetes is a complex and challenging disease for patients and the health systems. Measures that encourage health promotion practices are necessary because they presented a smaller proportion than the use of hypoglycemic agents. Public health policies should be implemented, and aimed mainly at older individuals with low income and schooling levels. These changes are essential to improve the health condition of older diabetic patients.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

A Rosetta Stone For Nature's Benefits To People.

After a long incubation period, the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES) is now underway. Underpinning all its activities is the IPBES Conceptual Framework (CF), a simplified model of the interactions between nature and people. Drawing on the legacy of previous large-scale environmental assessments, the CF goes further in explicitly embracing different disciplines and knowledge systems (including indigenous and local knowledge) in the co-construction of assessments of the state of the world's biodiversity and the benefits it provides to humans. The CF can be thought of as a kind of Rosetta Stone that highlights commonalities between diverse value sets and seeks to facilitate crossdisciplinary and crosscultural understanding. We argue that the CF will contribute to the increasing trend towards interdisciplinarity in understanding and managing the environment. Rather than displacing disciplinary science, however, we believe that the CF will provide new contexts of discovery and policy applications for it.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Obstacle Crossing With Dual Tasking Is A Danger For Individuals With Alzheimer's Disease And For Healthy Older People.

The aim of this study was to analyze the effects of dual tasking on obstacle crossing during walking by individuals with Alzheimer's disease (AD) and by healthy older people. Thirty four elderly individuals (16 healthy subjects and 18 individuals with AD) were recruited to participate in this study. Three AD individuals and one control participant were excluded due to exclusion criteria. The participants were instructed to walk barefoot at their own speed along an 8 m long pathway. Each participant performed five trials for each condition (unobstructed walking, unobstructed walking with dual tasking, and obstacle crossing during walking with dual tasking). The trials were completely randomized for each participant. The mid-pathway stride was measured in the unobstructed walking trials and the stride that occurred during the obstacle avoidance was measured in the trials that involved obstacle crossing. The behavior of the healthy elderly subjects and individuals with AD was similar for obstacle crossing during walking with dual tasking. Both groups used the posture first strategy to prioritize stability and showed decreased attention to executive tasking while walking. Additionally, AD had a strong influence on the modifications that are made by the elderly while walking under different walking conditions.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Impacto das atividades fisicas nos indicadores de saude de sujeitos adultos : programa mexa-se

Universidade Estadual de Campinas . Faculdade de Educação Física

As artes marciais chinesas para pessoas com deficiência : contextos, dilemas e possibilidades = Chinese martial arts for people with disabilities : contexts, dilemmas and possibilities

Universidade Estadual de Campinas . Faculdade de Educação Física

Escala de autoaceitação para pessoas com cegueira congênita ou precoce : desenvolvimento e investigação psicométrica = Self-acceptance acale for people with congenital or early blindness : development and psychometric analysis

Universidade Estadual de Campinas . Faculdade de Educação Física

1. Jogos Escolares Brasileiros da Confederação Brasileira de Desportos para Cegos : um estudo de caso

Universidade Estadual de Campinas . Faculdade de Educação Física