13 resultados para Pathogen infection
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.
Resumo:
Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.
Resumo:
Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.
Resumo:
Human bocavirus 1 (HBoV1) is associated with respiratory infections worldwide, mainly in children. Similar to other parvoviruses, it is believed that HBoV1 can persist for long periods of time in humans, probably through maintaining concatemers of the virus single-stranded DNA genome in the nuclei of infected cells. Recently, HBoV-1 was detected in high rates in adenoid and palatine tonsils samples from patients with chronic adenotonsillar diseases, but nothing is known about the virus replication levels in those tissues. A 3-year prospective hospital-based study was conducted to detect and quantify HBoV1 DNA and mRNAs in samples of the adenoids (AD), palatine tonsils (PT), nasopharyngeal secretions (NPS), and peripheral blood (PB) from patients undergoing tonsillectomy for tonsillar hypertrophy or recurrent tonsillitis. HBoV1 was detected in 25.3% of the AD samples, while the rates of detection in the PT, NPS, and PB samples were 7.2%, 10.5%, and 1.7%, respectively. The viral loads were higher in AD samples, and 27.3% of the patients with HBoV had mRNA detectable in this tissue. High viral loads and detectable mRNA in the AD were associated with HBoV1 detection in the other sample sites. The adenoids are an important site of HBoV1 replication and persistence in children with tonsillar hypertrophy. The adenoids contain high HBoV1 loads and are frequently positive for HBoV mRNA, and this is associated with the detection of HBoV1 in secretions.
Resumo:
Substantial complexity has been introduced into treatment regimens for patients with human immunodeficiency virus (HIV) infection. Many drug-related problems (DRPs) are detected in these patients, such as low adherence, therapeutic inefficacy, and safety issues. We evaluated the impact of pharmacist interventions on CD4+ T-lymphocyte count, HIV viral load, and DRPs in patients with HIV infection. In this 18-month prospective controlled study, 90 outpatients were selected by convenience sampling from the Hospital Dia-University of Campinas Teaching Hospital (Brazil). Forty-five patients comprised the pharmacist intervention group and 45 the control group; all patients had HIV infection with or without acquired immunodeficiency syndrome. Pharmaceutical appointments were conducted based on the Pharmacotherapy Workup method, although DRPs and pharmacist intervention classifications were modified for applicability to institutional service limitations and research requirements. Pharmacist interventions were performed immediately after detection of DRPs. The main outcome measures were DRPs, CD4+ T-lymphocyte count, and HIV viral load. After pharmacist intervention, DRPs decreased from 5.2 (95% confidence interval [CI] =4.1-6.2) to 4.2 (95% CI =3.3-5.1) per patient (P=0.043). A total of 122 pharmacist interventions were proposed, with an average of 2.7 interventions per patient. All the pharmacist interventions were accepted by physicians, and among patients, the interventions were well accepted during the appointments, but compliance with the interventions was not measured. A statistically significant increase in CD4+ T-lymphocyte count in the intervention group was found (260.7 cells/mm(3) [95% CI =175.8-345.6] to 312.0 cells/mm(3) [95% CI =23.5-40.6], P=0.015), which was not observed in the control group. There was no statistical difference between the groups regarding HIV viral load. This study suggests that pharmacist interventions in patients with HIV infection can cause an increase in CD4+ T-lymphocyte counts and a decrease in DRPs, demonstrating the importance of an optimal pharmaceutical care plan.
Resumo:
Urinary tract infection (UTI) is the most common infection posttransplant. However, the risk factors for and the impact of UTIs remain controversial. The aim of this study was to identify the incidence of posttransplant UTIs in a series of renal transplant recipients from deceased donors. Secondary objectives were to identify: (1) the most frequent infectious agents; (2) risk factors related to donor; (3) risk factors related to recipients; and (4) impact of UTI on graft function. This was a retrospective analysis of medical records from renal transplant patients from January to December 2010. Local ethics committee approved the protocol. The incidence of UTI in this series was 34.2%. Risk factors for UTI were older age, (independent of gender), biopsy-proven acute rejection episodes, and kidneys from deceased donors (United Network for Organ Sharing criteria). For female patients, the number of pretransplant pregnancies was an additional risk factor. Recurrent UTI was observed in 44% of patients from the UTI group. The most common infectious agents were Escherichia coli and Klebsiella pneumoniae, for both isolated and recurrent UTI. No difference in renal graft function or immunosuppressive therapy was observed between groups after the 1-year follow-up. In this series, older age, previous pregnancy, kidneys from expanded criteria donors, and biopsy-proven acute rejection episodes were risk factors for posttransplant UTI. Recurrence of UTI was observed in 44%, with no negative impact on graft function or survival.
Resumo:
Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.
Resumo:
To investigate endotoxin levels from primary endodontic infections before and after chemomechanical preparation (CMP) and to determine their antigenicity against 3T3 fibroblasts through gelatinolytic activity of matrix metalloproteinases (MMPs). Twenty-four root canals with primary endodontic infection and apical periodontitis were selected. Samples were collected using paper points before (S1) and after chemomechanical preparation (CMP) (S2). The limulus amebocyte lysate assay was used for endotoxin measurement. Fibroblasts were stimulated with root canal contents for 24 h. Supernatants of cell cultures stimulated with root canal contents were collected after 24 h to determine the levels of MMP-2 and MMP-9 gelatinolytic activity using the zymography technique. Friedman and Wilcoxon tests were used to compare the amount of endotoxin before (S1) and after CMP (S2) (P < 0.05). Data obtained from gelatinolytic activity were analysed using anova and Tukey's tests (P < 0.05). Endotoxin was recovered in 100% of the samples. There was a significant reduction in endotoxin levels after CMP (P < 0.05). A correlation was found between the levels of endotoxins and MMP-2 expression (P < 0.05). Root canal contents of initial samples (S1) induced significantly greater MMP-2 expression by fibroblasts when compared to S2 and the nonstimulated group (P < 0.05). No gelatinolytic activity of MMP-9 was observed in S1, S2 and control group. Root canal contents from primary endodontic infections had gelatinolytic activity for MMP-2. Moreover, CMP was effective in reducing endotoxin levels and their antigenicity against fibroblasts on gelatinolytic activity.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.