11 resultados para Passion fruit - Morphology

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

• We developed the first microsatellites for Passiflora setacea and characterized new sets of markers for P. edulis and P. cincinnata, enabling further genetic diversity studies to support the conservation and breeding of passion fruit species. • We developed 69 microsatellite markers and, in conjunction with assessments of cross-amplification using primers available from the literature, present 43 new polymorphic microsatellite loci for three species of Passiflora. The mean number of alleles per locus was 3.1, and the mean values of the expected and observed levels of heterozygosity were 0.406 and 0.322, respectively. • These microsatellite markers will be valuable tools for investigating the genetic diversity and population structure of wild and commercial species of passion fruit (Passiflora spp.) and may be useful for developing conservation and improvement strategies by contributing to the understanding of the mating system and hybridization within the genus.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The objective of the work was to evaluate the effects of environment, recipients, and substrate compositions in passion fruit (Passiflora edulis Sims f. flavicarpa Deg.) seedlings biomass production in Pantanal region from September to November of 2006. Experimental trials were conducted in four protected environments, in two types of containers and three different substrate compositions. The environments were: A1 (greenhouse covered with low-density, 150-microns-thick polyethylene film), A2 (monofilament black screened with mesh for 50% of shade), A3 (aluminized screened with mesh for 50% of shade) and A4 (environment covered with straw of native coconut palm); the recipients were: polyethylene bags (R1) (15 x 25 cm) and polystyrene trays (R2) (with 72 cells). There substrates were: S1 (soil + organic compost + vermiculite, 1:1: 1 v/v), S2 (soil + organic compost + sawdust, 1:1: 1 v/v) and S3 (soil + organic compost + vermiculite + sawdust, 1:1: 1/2: 1/2 v/v). The experimental design was completely randomized statistical analysis in split-split-plot, with fifteen replications. The treatments in the plot were environments, in the subplots were pots, and subsubplots were substrates (4 x 2 x 3 = 24 treatments). Fresh and dry mass of aerial and root system parts were evaluated. Environments with screen showed better results for seedlings of yellow passion fruit biomass in polyethylene bags. Polyethylene bags promoted higher biomasses. The substrate with vermiculite showed better results for both types of containers. The substrate with a higher percentage of sawdust showed the worst result.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim was to evaluate the relationship between orofacial function, dentofacial morphology, and bite force in young subjects. Three hundred and sixteen subjects were divided according to dentition stage (early, intermediate, and late mixed and permanent dentition). Orofacial function was screened using the Nordic Orofacial Test-Screening (NOT-S). Orthodontic treatment need, bite force, lateral and frontal craniofacial dimensions and presence of sleep bruxism were also assessed. The results were submitted to descriptive statistics, normality and correlation tests, analysis of variance, and multiple linear regression to test the relationship between NOT-S scores and the studied independent variables. The variance of NOT-S scores between groups was not significant. The evaluation of the variables that significantly contributed to NOT-S scores variation showed that age and presence of bruxism related to higher NOT-S total scores, while the increase in overbite measurement and presence of closed lip posture related to lower scores. Bite force did not show a significant relationship with scores of orofacial dysfunction. No significant correlations between craniofacial dimensions and NOT-S scores were observed. Age and sleep bruxism were related to higher NOT-S scores, while the increase in overbite measurement and closed lip posture contributed to lower scores of orofacial dysfunction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Energy dispersive X-ray spectroscopy microanalysis (EDX), scanning electron microscopy (SEM), and Archimedes' Principle were used to determine the characteristics of inorganic filler particles in five dental alginates, including Cavex ColorChange (C), Hydrogum 5 (H5), Hydrogum (H), Orthoprint (O), and Jeltrate Plus (JP). The different alginate powders (0.5 mg) were fixed on plastic stubs (n = 5) and sputter coated with carbon for EDX analysis, then coated with gold, and observed using SEM. Volume fractions were determined by weighing a sample of each material in water before and after calcining at 450(°)C for 3 h. The alginate materials were mainly composed of silicon (Si) by weight (C-81.59%, H-79.89%, O-78.87%, H5-77.95%, JP-66.88%, wt). The filler fractions in volume (vt) were as follows: H5-84.85%, JP-74.76%, H-70.03%, O-68.31%, and C-56.10%. The tested materials demonstrated important differences in the inorganic elemental composition, filler fraction, and particle morphology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this work was to describe the morphology and ontogeny of P. riedelii fruits to aid in taxonomic, ecological and phylogenetic studies in Apocynaceae. Fruits were fixed in FAA, embedded in plastic resin, sectioned at 10 ìm and stained with toluidine blue, for structural analysis. The fruit of P. riedelii is a follicarium, with two follicular fruitlets. The epicarp is one-cell-layered, with trichomes and thick cuticle. The mesocarp, originating from fundamental ovary tissue, is parenchymatous with laticifers, non-lignified fibers and vascular bundles. The endocarp sensu lato is two-celllayered of crossed sclereids, originating from the inner ovary epidermis and from a single layer of parenchyma cells of fundamental ovary tissue. Follicle dehiscence is lateral and the dehiscence process involves anatomical characteristics such as a dehiscence zone with thin-walled cells, non-lignified fibers in the mesocarp and crossed sclereids in the endocarp.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.