63 resultados para PCR analysis

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

70.00% 70.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Fourier transform-infrared (FT-IR) signature of dry samples of DNA and DNA-polypeptide complexes, as studied by IR microspectroscopy using a diamond attenuated total reflection (ATR) objective, has revealed important discriminatory characteristics relative to the PO2(-) vibrational stretchings. However, DNA IR marks that provide information on the sample's richness in hydrogen bonds have not been resolved in the spectral profiles obtained with this objective. Here we investigated the performance of an all reflecting objective (ARO) for analysis of the FT-IR signal of hydrogen bonds in DNA samples differing in base richness types (salmon testis vs calf thymus). The results obtained using the ARO indicate prominent band peaks at the spectral region representative of the vibration of nitrogenous base hydrogen bonds and of NH and NH2 groups. The band areas at this spectral region differ in agreement with the DNA base richness type when using the ARO. A peak assigned to adenine was more evident in the AT-rich salmon DNA using either the ARO or the ATR objective. It is concluded that, for the discrimination of DNA IR hydrogen bond vibrations associated with varying base type proportions, the use of an ARO is recommended.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although various abutment connections and materials have recently been introduced, insufficient data exist regarding the effect of stress distribution on their mechanical performance. The purpose of this study was to investigate the effect of different abutment materials and platform connections on stress distribution in single anterior implant-supported restorations with the finite element method. Nine experimental groups were modeled from the combination of 3 platform connections (external hexagon, internal hexagon, and Morse tapered) and 3 abutment materials (titanium, zirconia, and hybrid) as follows: external hexagon-titanium, external hexagon-zirconia, external hexagon-hybrid, internal hexagon-titanium, internal hexagon-zirconia, internal hexagon-hybrid, Morse tapered-titanium, Morse tapered-zirconia, and Morse tapered-hybrid. Finite element models consisted of a 4×13-mm implant, anatomic abutment, and lithium disilicate central incisor crown cemented over the abutment. The 49 N occlusal loading was applied in 6 steps to simulate the incisal guidance. Equivalent von Mises stress (σvM) was used for both the qualitative and quantitative evaluation of the implant and abutment in all the groups and the maximum (σmax) and minimum (σmin) principal stresses for the numerical comparison of the zirconia parts. The highest abutment σvM occurred in the Morse-tapered groups and the lowest in the external hexagon-hybrid, internal hexagon-titanium, and internal hexagon-hybrid groups. The σmax and σmin values were lower in the hybrid groups than in the zirconia groups. The stress distribution concentrated in the abutment-implant interface in all the groups, regardless of the platform connection or abutment material. The platform connection influenced the stress on abutments more than the abutment material. The stress values for implants were similar among different platform connections, but greater stress concentrations were observed in internal connections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Current guidelines have advised against the performance of (131)I-iodide diagnostic whole body scintigraphy (dxWBS) to minimize the occurrence of stunning, and to guarantee the efficiency of radioiodine therapy (RIT). The aim of the study was to evaluate the impact of stunning on the efficacy of RIT and disease outcome. This retrospective analysis included 208 patients with differentiated thyroid cancer managed according to a same protocol and followed up for 12-159 months (mean 30 ± 69 months). Patients received RIT in doses ranging from 3,700 to 11,100 MBq (100 mCi to 300 mCi). Post-RIT-whole body scintigraphy images were performed 10 days after RIT in all patients. In addition, images were also performed 24-48 hours after therapy in 22 patients. Outcome was classified as no evidence of disease (NED), stable disease (SD) and progressive disease (PD). Thyroid stunning occurred in 40 patients (19.2%), including 26 patients with NED and 14 patients with SD. A multivariate analysis showed no association between disease outcome and the occurrence of stunning (p = 0.3476). The efficacy of RIT and disease outcome do not seem to be related to thyroid stunning.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We report on a new analysis of neutrino oscillations in MINOS using the complete set of accelerator and atmospheric data. The analysis combines the ν(μ) disappearance and ν(e) appearance data using the three-flavor formalism. We measure |Δm(32)(2)| = [2.28-2.46] × 10(-3) eV(2) (68% C.L.) and sin(2)θ(23) = 0.35-0.65 (90% C.L.) in the normal hierarchy, and |Δm(32)(2)| = [2.32-2.53] × 10(-3) eV(2) (68% C.L.) and sin(2)θ(23) = 0.34-0.67 (90% C.L.) in the inverted hierarchy. The data also constrain δ(CP), the θ(23} octant degeneracy and the mass hierarchy; we disfavor 36% (11%) of this three-parameter space at 68% (90%) C.L.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, 103 unrelated South-American patients with mucopolysaccharidosis type II (MPS II) were investigated aiming at the identification of iduronate-2-sulfatase (IDS) disease causing mutations and the possibility of some insights on the genotype-phenotype correlation The strategy used for genotyping involved the identification of the previously reported inversion/disruption of the IDS gene by PCR and screening for other mutations by PCR/SSCP. The exons with altered mobility on SSCP were sequenced, as well as all the exons of patients with no SSCP alteration. By using this strategy, we were able to find the pathogenic mutation in all patients. Alterations such as inversion/disruption and partial/total deletions of the IDS gene were found in 20/103 (19%) patients. Small insertions/deletions/indels (<22 bp) and point mutations were identified in 83/103 (88%) patients, including 30 novel mutations; except for a higher frequency of small duplications in relation to small deletions, the frequencies of major and minor alterations found in our sample are in accordance with those described in the literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate the degree of T2 relaxometry changes over time in groups of patients with familial mesial temporal lobe epilepsy (FMTLE) and asymptomatic relatives. We conducted both cross-sectional and longitudinal analyses of T2 relaxometry with Aftervoxel, an in-house software for medical image visualization. The cross-sectional study included 35 subjects (26 with FMTLE and 9 asymptomatic relatives) and 40 controls; the longitudinal study was composed of 30 subjects (21 with FMTLE and 9 asymptomatic relatives; the mean time interval of MRIs was 4.4 ± 1.5 years) and 16 controls. To increase the size of our groups of patients and relatives, we combined data acquired in 2 scanners (2T and 3T) and obtained z-scores using their respective controls. General linear model on SPSS21® was used for statistical analysis. In the cross-sectional analysis, elevated T2 relaxometry was identified for subjects with seizures and intermediate values for asymptomatic relatives compared to controls. Subjects with MRI signs of hippocampal sclerosis presented elevated T2 relaxometry in the ipsilateral hippocampus, while patients and asymptomatic relatives with normal MRI presented elevated T2 values in the right hippocampus. The longitudinal analysis revealed a significant increase in T2 relaxometry for the ipsilateral hippocampus exclusively in patients with seizures. The longitudinal increase of T2 signal in patients with seizures suggests the existence of an interaction between ongoing seizures and the underlying pathology, causing progressive damage to the hippocampus. The identification of elevated T2 relaxometry in asymptomatic relatives and in patients with normal MRI suggests that genetic factors may be involved in the development of some mild hippocampal abnormalities in FMTLE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Congenital muscular dystrophy with laminin α2 chain deficiency (MDC1A) is one of the most severe forms of muscular disease and is characterized by severe muscle weakness and delayed motor milestones. The genetic basis of MDC1A is well known, yet the secondary mechanisms ultimately leading to muscle degeneration and subsequent connective tissue infiltration are not fully understood. In order to obtain new insights into the molecular mechanisms underlying MDC1A, we performed a comparative proteomic analysis of affected muscles (diaphragm and gastrocnemius) from laminin α2 chain-deficient dy(3K)/dy(3K) mice, using multidimensional protein identification technology combined with tandem mass tags. Out of the approximately 700 identified proteins, 113 and 101 proteins, respectively, were differentially expressed in the diseased gastrocnemius and diaphragm muscles compared with normal muscles. A large portion of these proteins are involved in different metabolic processes, bind calcium, or are expressed in the extracellular matrix. Our findings suggest that metabolic alterations and calcium dysregulation could be novel mechanisms that underlie MDC1A and might be targets that should be explored for therapy. Also, detailed knowledge of the composition of fibrotic tissue, rich in extracellular matrix proteins, in laminin α2 chain-deficient muscle might help in the design of future anti-fibrotic treatments. All MS data have been deposited in the ProteomeXchange with identifier PXD000978 (http://proteomecentral.proteomexchange.org/dataset/PXD000978).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The new social panorama resulting from aging of the Brazilian population is leading to significant transformations within healthcare. Through the cluster analysis strategy, it was sought to describe the specific care demands of the elderly population, using frailty components. Cross-sectional study based on reviewing medical records, conducted in the geriatric outpatient clinic, Hospital de Clínicas, Universidade Estadual de Campinas (Unicamp). Ninety-eight elderly users of this clinic were evaluated using cluster analysis and instruments for assessing their overall geriatric status and frailty characteristics. The variables that most strongly influenced the formation of clusters were age, functional capacities, cognitive capacity, presence of comorbidities and number of medications used. Three main groups of elderly people could be identified: one with good cognitive and functional performance but with high prevalence of comorbidities (mean age 77.9 years, cognitive impairment in 28.6% and mean of 7.4 comorbidities); a second with more advanced age, greater cognitive impairment and greater dependence (mean age 88.5 years old, cognitive impairment in 84.6% and mean of 7.1 comorbidities); and a third younger group with poor cognitive performance and greater number of comorbidities but functionally independent (mean age 78.5 years old, cognitive impairment in 89.6% and mean of 7.4 comorbidities). These data characterize the profile of this population and can be used as the basis for developing efficient strategies aimed at diminishing functional dependence, poor self-rated health and impaired quality of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Balsamic vinegar (BV) is a typical and valuable Italian product, worldwide appreciated thanks to its characteristic flavors and potential health benefits. Several studies have been conducted to assess physicochemical and microbial compositions of BV, as well as its beneficial properties. Due to highly-disseminated claims of antioxidant, antihypertensive and antiglycemic properties, BV is a known target for frauds and adulterations. For that matter, product authentication, certifying its origin (region or country) and thus the processing conditions, is becoming a growing concern. Striving for fraud reduction as well as quality and safety assurance, reliable analytical strategies to rapidly evaluate BV quality are very interesting, also from an economical point of view. This work employs silica plate laser desorption/ionization mass spectrometry (SP-LDI-MS) for fast chemical profiling of commercial BV samples with protected geographical indication (PGI) and identification of its adulterated samples with low-priced vinegars, namely apple, alcohol and red/white wines.