11 resultados para PARACOCCIDIOIDES-BRASILIENSIS CONIDIA

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Paracoccidioidomycosis (PCM) and tuberculosis (TB) are chronic granulomatous infectious diseases, in which the main form of contraction is through inhalation of the microorganism-Paracoccidioides brasiliensis and Mycobacterium tuberculosis. Oral involvement of PCM is observed in up to 70 % of the cases and usually presents clinically as ulcerations with granular surface showing tiny hemorrhagic areas. Oral presentation of TB is rare with prevalence smaller than 0.5 % of all cases. Clinical presentation of oral TB mainly consists of single ulcers with irregular limits and necrotic base. A 70-year-old immunocompetent man presented simultaneously oral PCM and pulmonary TB. Medical history revealed a previous diagnosis of pulmonary TB; however, even under treatment for TB, the patient remained with oral lesions and intense pulmonary fibrosis. The physician requested P. brasiliensis serological analysis, which resulted positive. Although the combination of PCM and TB has been reported in the literature, it is still considered an uncommon condition and their diagnosis may represent a challenge to healthcare professionals because of the similarity between their clinical and radiological presentations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hevea brasiliensis (Willd. Ex Adr. Juss.) Muell.-Arg. is the primary source of natural rubber that is native to the Amazon rainforest. The singular properties of natural rubber make it superior to and competitive with synthetic rubber for use in several applications. Here, we performed RNA sequencing (RNA-seq) of H. brasiliensis bark on the Illumina GAIIx platform, which generated 179,326,804 raw reads on the Illumina GAIIx platform. A total of 50,384 contigs that were over 400 bp in size were obtained and subjected to further analyses. A similarity search against the non-redundant (nr) protein database returned 32,018 (63%) positive BLASTx hits. The transcriptome analysis was annotated using the clusters of orthologous groups (COG), gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Pfam databases. A search for putative molecular marker was performed to identify simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs). In total, 17,927 SSRs and 404,114 SNPs were detected. Finally, we selected sequences that were identified as belonging to the mevalonate (MVA) and 2-C-methyl-D-erythritol 4-phosphate (MEP) pathways, which are involved in rubber biosynthesis, to validate the SNP markers. A total of 78 SNPs were validated in 36 genotypes of H. brasiliensis. This new dataset represents a powerful information source for rubber tree bark genes and will be an important tool for the development of microsatellites and SNP markers for use in future genetic analyses such as genetic linkage mapping, quantitative trait loci identification, investigations of linkage disequilibrium and marker-assisted selection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The reproductive capacity between Triatoma lenti and Triatoma sherlocki was observed in order to verify the fertility and viability of the offspring. Cytogenetic, morphological and morphometric approaches were used to analyze the differences that were inherited. Experimental crosses were performed in both directions. The fertility rate of the eggs in crosses involving T. sherlocki females was 65% and 90% in F1 and F2 offspring, respectively. In reciprocal crosses, it was 7% and 25% in F1 and F2 offspring, respectively. The cytogenetic analyses of the male meiotic process of the hybrids were performed using lacto-acetic orcein, C-banding and Feulgen techniques. The male F1 offspring presented normal chromosome behavior, a finding that was similar to those reported in parental species. However, cytogenetic analysis of F2 offspring showed errors in chromosome pairing. This post-zygotic isolation, which prevents hybrids in nature, may represent the collapse of the hybrid. This phenomenon is due to a genetic dysregulation that occurs in the chromosomes of F1. The results were similar in the hybrids from both crosses. Morphological features, such as color and size of connexive and the presence of red-orange rings on the femora, were similar to T. sherlocki, while wins size was similar to T. lenti in F1 offspring. The eggshells showed characteristics that were similar to species of origin, whereas the median process of the pygophore resulted in intermediate characteristics in the F1 and a segregating pattern in F2 offspring. Geometric morphometric techniques used on the wings showed that both F1 and F2 offspring were similar to T. lenti. These studies on the reproductive capacity between T. lenti and T. sherlocki confirm that both species are evolutionarily closed; hence, they are included in the brasiliensis subcomplex. The extremely reduced fertility observed in the F2 hybrids confirmed the specific status of the species that were analyzed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Relationships among floral biology, floral micromorphology and pollinator behaviour in bird-pollinated orchids are important issues to understand the evolution of the huge flower diversity within Orchidaceae. We aimed to investigate floral mechanisms underlying the interaction with pollinators in two hummingbird-pollinated orchids occurring in the Atlantic forest. We assessed floral biology, nectar traits, nectary and column micromorphologies, breeding systems and pollinators. In both species, nectar is secreted by lip calli through spaces between the medial lamellar surfaces of epidermal cells. Such form of floral nectar secretion has not been previously described. Both species present functional protandry and are self-compatible yet pollinator-dependent. Fruit sets in hand-pollination experiments were more than twice those under natural conditions, evidencing pollen limitation. The absence of fruit set in interspecific crosses suggests the existence of post-pollination barriers between these synchronopatric species. In Elleanthus brasiliensis, fruits resulting from cross-pollination and natural conditions were heavier than those resulting from self-pollination, suggesting advantages to cross-pollination. Hummingbirds pollinated both species, which share at least one pollinator species. Species differences in floral morphologies led to distinct pollination mechanisms. In E. brasiliensis, attachment of pollinaria to the hummingbird bill occurs through a lever apparatus formed by an appendage in the column, another novelty to the knowledge of orchids. In E. crinipes, pollinaria attachment occurs by simple contact with the bill during insertion into the flower tube, which fits tightly around the bill. The novelties described here illustrate the overlooked richness in ecology and morphophysiology in Orchidaceae. This article is protected by copyright. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An inventory of the woody flora (trees and shrubs), was carried out in the Ribeirão Cachoeria forest (233.7ha, 650m high, 46°55'58''W, 22°50'13''S), the second largest and best conserved fragment of semideciduous tropical forest in the municipality of Campinas, São Paulo state, Southeastern Brazil. The soil is a red-yellow podsol and the climate is of Köppen's Cwag type. Collections were made from August/1996 to September/1997. Only fertile individuals with a perimeter at breast height of 9cm or greater were included in the survey. One hyndred and seventhy five species were identified, belonging to 119 genera and 49 families. The most important families were Myrtaceae (14 species), Rutaceae and Fabaceae (13), Caesalpiniaceae (11), Solanaceae (9), and Rubiaceae (8). Some species were found for the first time in the region: Tachigali multijuga Benth. and Schoepfia brasiliensis A.DC. The flowering peak for most species was from August to October. Maximum fruit production was from August to November. Most species are zoochoric (58%), but 23% were anemochoric and 19% autochoric. The floristic composition of this forest and another 20 forests from São Paulo state were compared. The results obtained indicate the existence of distinct groups of forests. The most homogeneus group contains forests from the municipality of Campinas with similarity of 40%. This suggests that these forests are possibly fragments of a original continuous forest in the Campinas region.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A study of the tree species of the order Celastrales sensu Cronquist from the Tibagi river basin, Paraná state, Brazil, is presented, based on herbarium material. This basin is subdivided into three zones, from north to south: lower Tibagi (BT), mid Tibagi (MT) and upper Tibagi (AT), each with different environmental conditions and vegetation types. The order Celastrales is represented in the basin by 15 tree species belonging to three families: Aquifoliaceae, Celastraceae and Icacinaceae. Icacinaceae has only two species, Citronella gongonha and C. paniculata. The former is distinguished by a glabrous ovary and leaves that usually bear thorns. Aquifoliaceae has six species: Ilex brasiliensis, I. brevicuspis, I. chamaedryfolia, I. dumosa, I. paraguariensis and I. theezans. These species are found mainly in AT and MT and are distinguished by leaf size, indument, apices and margins, and by sepal features. Celastrales is represented by seven species and two genera; Plenckia populnea, a Brazilian savannah species found only in MT, and six species of Maytenus (M. evonymoides, M. robusta, M. dasyclada, M. salicifolia, M. ilicifolia and M. aquifolia) distinguished by leaf size and margins, branch shape and number of flowers per inflorescence.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.