Avaliação in vitro do aparelho DIAGNOdent para diagnóstico oclusal

The aim of this study was to determine the effectiveness and reliability of laser fluorescence measurements in relation to occlusal caries diagnosis. DIAGNOdent 2095 (Kavo, Biberach, Germany), which has been developed especially for caries diagnosis, was utilized. Five (5) teeth were examined in the pilot test; after that, ten (10) teeth were examined in order to calibrate both examiners. Data were obtained from 66 teeth (36 molars and 30 premolars), totalizing 144 sites identified through photographs of the occlusal surfaces. Reproducibility was evaluated in 10 teeth. The interexaminer Spearman correlation (r) was 0.89 and the intra-examiner, 0.93 and 0.97 (examiner A and B, respectively). Validation was carried out by histological examination (stereomicroscope). For the two examiners the sensitivity of the device was relatively high, varying from 0.81 to 1.00, while specificity varied according to which validation criterion was used (0.77 - 0.86: enamel lesion / 0.52 - 0.59: dentin lesion). It was concluded that DIAGNodent presented good capacity of identifying any alteration of the dental surface, nevertheless it presents the disadvantage of accomplishing many false-positive diagnosis when the validation criterion is dentin lesion.

Mastication Movements And Sleep Quality Of Patients With Myofascial Pain: Occlusal Device Therapy Improvements.

Patients with myofascial pain experience impaired mastication, which might also interfere with their sleep quality. The purpose of this study was to evaluate the jaw motion and sleep quality of patients with myofascial pain and the impact of a stabilization device therapy on both parameters. Fifty women diagnosed with myofascial pain by the Research Diagnostic Criteria were enrolled. Pain levels (visual analog scale), jaw movements (kinesiography), and sleep quality (Epworth Sleepiness Scale; Pittsburgh Sleep Quality Index) were evaluated before (control) and after stabilization device use. Range of motion (maximum opening, right and left excursions, and protrusion) and masticatory movements during Optosil mastication (opening, closing, and total cycle time; opening and closing angles; and maximum velocity) also were evaluated. Repeated-measures analysis of variance in a generalized linear mixed models procedure was used for statistical analysis (α=.05). At baseline, participants with myofascial pain showed a reduced range of jaw motion and poorer sleep quality. Treatment with a stabilization device reduced pain (P<.001) and increased both mouth opening (P<.001) and anteroposterior movement (P=.01). Also, after treatment, the maximum opening (P<.001) and closing (P=.04) velocities during mastication increased, and improvements in sleep scores for the Pittsburgh Sleep Quality Index (P<.001) and Epworth Sleepiness Scale (P=.04) were found. Myofascial pain impairs jaw motion and quality of sleep; the reduction of pain after the use of a stabilization device improves the range of motion and sleep parameters.

Photoelastic And Finite Element Analyses Of Occlusal Loads In Mandibular Body.

This study proposed to evaluate the mandibular biomechanics in the posterior dentition based on experimental and computational analyses. The analyses were performed on a model of human mandible, which was modeled by epoxy resin for photoelastic analysis and by computer-aided design for finite element analysis. To standardize the evaluation, specific areas were determined at the lateral surface of mandibular body. The photoelastic analysis was configured through a vertical load on the first upper molar and fixed support at the ramus of mandible. The same configuration was used in the computer simulation. Force magnitudes of 50, 100, 150, and 200 N were applied to evaluate the bone stress. The stress results presented similar distribution in both analyses, with the more intense stress being at retromolar area and oblique line and alveolar process at molar level. This study presented the similarity of results in the experimental and computational analyses and, thus, showed the high importance of morphology biomechanical characterization at posterior dentition.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Fluoride Concentrations In The Water Of Maringá, Brazil, Considering The Benefit/risk Balance Of Caries And Fluorosis.

Current Brazilian law regarding water fluoridation classification is dichotomous with respect to the risks of and benefits for oral diseases, and fluoride (F) concentrations less than 0.6 or above 0.8 mg F/L are considered outside the normal limits. Thus, the law does not consider that both caries and fluorosis are dependent on the dosage and duration of fluoride exposure because they are both chronic diseases. Therefore, this study evaluated the quality of water fluoridation in Maringá, PR, Brazil, considering a new classification for the concentration of F in water the supply, based on the anticaries benefit and risk of fluorosis (CECOL/USP, 2011). Water samples (n = 325) were collected monthly over one year from 28 distribution water networks: 20 from treatment plants and 8 from artesian wells. F concentrations were determined using a specific ion electrode. The average F concentration was 0.77 mg F/L (ppm F), ranging from 0.44 to 1.22 mg F/L. Considering all of the water samples analyzed, 83.7% of them presented from 0.55 to 0.84 mg F/L, and according to the new classification used, they would provide maximum anticaries benefit with a low risk of fluorosis. This percentage was lower (75.4%) in the water samples supplied from artesian wells than from those distributed by the treatment plant (86%). In conclusion, based on the new classification of water F concentrations, the quality of water fluoridation in Maringá is adequate and is within the range of the best balance between risk and benefit.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Análise de custo-efetividade de métodos preventivos para superfície oclusal de acordo com o risco de cárie: resultados de um ensaio clínico controlado

This study presents the results of a cost-effectiveness analysis in a controlled clinical trial on the effectiveness of a modified glass ionomer resin sealant ( Vitremer, 3M ESPE) and the application of fluoride varnish (Duraphat, Colgate) on occlusal surfaces of first permanent molars in children 6-8 years of age (N = 268), according to caries risk (high versus low). Children were examined semiannually by the same calibrated dentist for 24 months after allocation in six groups: high and low risk controls (oral health education every three months); high and low risk with varnish (oral health education every three months + varnish biannually); and high and low risk with sealant (oral health education every three months + a single application of sealant). Economic analysis showed that sealing permanent first molars of high-risk schoolchildren showed a C/E ratio of US$ 119.80 per saved occlusal surface and an incremental C/E ratio of US$ 108.36 per additional saved occlusal surface. The study concluded that sealing permanent first molars of high-risk schoolchildren was the most cost-effective intervention.

Efeito cariostático de restaurações adesivas em superfícies radiculares: estudo in vitro

Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.